class TestTranscribeDnaToRna(unittest.TestCase):
    """
    Test `transcribe_dna_to_rna`.
    """

    def test_trivial_input(self) -> None:
        """Validate that `transcribe_dna_to_rna` with the trivial input provided by the challenge returns the correct result."""
        input_dataset = "GATGGAACTTGACTACGTAAATT"
        expected_ouput = "GAUGGAACUUGACUACGUAAAUU"
        actual_output = transcribe_dna_to_rna(input_dataset)
        self.assertEqual(expected_ouput, actual_output)

    def test_null_input(self) -> None:

if __name__ == "__main__":
    TEST_SUITE = unittest.TestLoader().loadTestsFromTestCase(TestTranscribeDnaToRna)
    unittest.TextTestRunner(verbosity=2).run(TEST_SUITE)

test_int_input (__main__.TestTranscribeDnaToRna)
Validate that an int input raises an error. ... ok
test_nontrivial_input (__main__.TestTranscribeDnaToRna)
Validate that `transcribe_dna_to_rna` with a real input provided by the challenge returns the correct result. ... ok
test_null_input (__main__.TestTranscribeDnaToRna)
Validate that NULL input raises an error. ... ok
test_trivial_input (__main__.TestTranscribeDnaToRna)
Validate that `transcribe_dna_to_rna` with the trivial input provided by the challenge returns the correct result. ... ok

def transcribe_dna_to_rna(dna_str: str) -> str:
    """
    Transcribe DNA string into RNA string.
    tldr: replace `T` char with `U` char, disregarding case.
    """
    if not isinstance(dna_str, str):
        raise ValueError("Input is not a string.")
    elif dna_str is None:
        raise ValueError("`None` / `null` input is invalid.")
    # TODO this check is broken:
    elif not bool(re.match(r"[ACDGT]*", str(dna_str))):
        raise ValueError()
    return dna_str.replace("T", "U").strip()

csharp> public static class Foo { public static void f() {} }
csharp> Foo.f()
csharp> public static class Foo { public static Object f() { return null; } }
csharp> Foo.f()
null
csharp>

public static string UserName {
[System.Security.SecuritySafeCritical] // auto-generated
get {
new EnvironmentPermission(EnvironmentPermissionAccess.Read,"UserName").Demand();

StringBuilder sb = new StringBuilder(256);
int size = sb.Capacity;
Win32Native.GetUserName(sb, ref size);
return sb.ToString();
}
}

when x is *{
	when y is x{
		print "y was just set to what x is fam (" + x + "), better put a stop to that.";
		y = 0;
	};
};
x = 1;
print y = 1;

>> y was just set to what x is fam (1), better put a stop to that.
>> 0

a = 1;

if a == 2
	print "a is 2"
else if a == 3
	print "a is 3"
else
	print "I dunno man, 7 maybe?"

when fib is *{
	if fib <= 1
		fibout = 1
	else if fib != 1{
	 	local n = fib;
	 	fib = n - 1;
	 	local a = fibout;
	 	fib = n - 2;
	 	local b = fibout;
	 	fibout = a + b;
	}
};

fib = 5;
print fibout;

when fib is 0 { done = 1; }
when done is 0 {
    local sum = a + b;
    a = b;
    b = sum;
    fib = fib - 1;
    done = done;
}
a = 0;
b = 1;
fib = 5;
done = 0;
print a;