The Nineteenth Byte

Unrelated String

20:00

D¦

user

@cairdcoinheringaahing Try a ∩ for the bottom

pxeger

@taRadvylfsriksushilani looks sleepy/yawny to me

Ginger Industries

I return

Unrelated String

bored perhaps

user

I love how humans can find faces in anything

caird coinheringaahing

20:00

Pareidolia :P

Adám

@user ¯ᗝ¯

ta Radvylf srik su shilani

-n- is the closest I can get with ASCII

_ _
 n

Two lines of ASCII, looks better than I expected

Ginger Industries

one second while I design a power plug for that country we were going to make in Wisconsin

user

Ginger Industries

@user me_irl

ta Radvylf srik su shilani

20:09

Idea: conlang where the only 1st person pronoun is "ya boi"

Ginger Industries

there you go!

brb

ta Radvylf srik su shilani

Genius design

caird coinheringaahing

Ugh, images are such a hassle

ta Radvylf srik su shilani

Lol

caird coinheringaahing

Tempted to do this, ngl :P

New semester starts tomorrow, so new lecturers :P

Ginger Industries

20:14

back

@taRadvylfsriksushilani glad you like it

user

@cairdcoinheringaahing "accidentally"

caird coinheringaahing

@user I mean, I've said stupider stuff to people when they ask me something and I'm only half listening

Ginger Industries

@cairdcoinheringaahing I can't see this image because reasons, what does it say?

ta Radvylf srik su shilani

I actually kind of like the idea of having a plug where the grounding is a circle that goes around the hot/neutral

Ginger Industries

@taRadvylfsriksushilani happy to help

ta Radvylf srik su shilani

20:16

@GingerIndustries "A professor asked me if I prefer 'Miss' or 'Mister' (because nb) and I accidentally said 'ya boi' without thinking so now I have a professor that calls me 'ya boi Rogers' every time I see him"

Ginger Industries

@taRadvylfsriksushilani but the last time you said something like that we got a new language

ta Radvylf srik su shilani

And a comment under it says "I'm not seeing the problem???"

caird coinheringaahing

Transcription:

Tumblr post by yangire-mun:
A professor asked if I prefer "Miss" or "Mister" (because nb) and I accidentally said "ya boi" without thinking so now I have a professor that calls me "ya boi Rogers" every time I see him.

Comment by silverletomi:
I'm not seeing the problem???

user

Good human

Ginger Industries

@taRadvylfsriksushilani I am amused but for a hot second I thought you were referring to yourself

caird coinheringaahing

20:17

I need to get better at my image transcription, that took me way too long :P

Ginger Industries

the existence of a "hot second" implies the existence of the more mundane "lukewarm second"

Ridiculous things discussed in TNB #10200: The best kind of power plug

caird coinheringaahing

The phrase "what the entire fuck" implies the existence of fractional fucks. "what the absolute fuck" implies negative fucks. "what the actual fuck" implies imaginary fucks. I conclude therefore that the field of fucks is isomorphic with the complex field

3

Ginger Industries

@cairdcoinheringaahing ...said someone on tumblr, probably

caird coinheringaahing

Twitter, actually :P

user

@cairdcoinheringaahing I would recommend training yourself on Kaggle. I was having some image classification problems, but fitting myself on some Kaggle datasets totally solved it!

Ginger Industries

20:20

that has an aura of \T.*r\-osity

caird coinheringaahing

@GingerIndustries We all know that no joke on the internet is original, it's just repeating what someone repeated

I believe that was originally said by Archimedes

Ginger Industries

this specific message (not the one above it) will be repeated weeks from now with no context

user

@cairdcoinheringaahing No, the saying was merely attributed to him, but someone else actually came up with it

caird coinheringaahing

@user Ah, Einstein's Law

pxeger

Ginger Industries

20:24

Ginger's Second Law of Stack Exchange: If we didn't write it you shouldn't trust it

user

So I shouldn't trust your law either

caird coinheringaahing

@pxeger This however is true, as we all know the internet was invented in 1932 by President Abraham Lincoln, hours before he was shot by Lee Harvey Oswald

Ginger Industries

@user I wrote it, which means it's trustable

@cairdcoinheringaahing This is wrong. Everyone knows he invented it in 1934

caird coinheringaahing

@GingerIndustries Ah my bad, I thought something was wrong with that

Ginger Industries

(in case you're curious [for some reason], Ginger's First Law mathematically defines the relationship between amount of code copied from SE and likelihood of the program running correctly)

user

20:34

@cairdcoinheringaahing Yes, that was a terrible affair. How awful for our glorious second American President to be shot down while nuking our enemies from his bald eagle

caird coinheringaahing

@taRadvylfsriksushilani Ooh, the red Redwolf is back :P

ta Radvylf srik su shilani

Huh, for me SE is still caching it

caird coinheringaahing

Chat still caches it for me, but I noticed in the review queues :P

Ginger Industries

@user keep in mind that the eagle wasn't yet equipped with chemtrail dispensers. Those came along some time later, prompted by Eli Whitney's killing of John Adams during the First World War.

caird coinheringaahing

Haha, New Posts has been nominated in Best Of :P

emanresu A

20:38

That was redwolf

caird coinheringaahing

Could that potentially count as sock puppet violations?

emanresu A

¯\_(ツ)_/¯

ta Radvylf srik su shilani

I don't think so. I suppose I could clarify it's a partial self-nomination, but I'm quite sure it won't win :p

user

This is hilarious, can we vote for New Posts and then give the bounty to me? :P

caird coinheringaahing

I guess not, as Redwolf could have done it as a self-nomination from New Posts, thus never having interaction between the accounts

ta Radvylf srik su shilani

20:39

"It had a refreshing lack of strategy or intelligence" isn't exactly the best sales pitch anyway :p

caird coinheringaahing

So long as Redwolf doesn't vote for New Posts, it should be all good :P

Ginger Industries

see also: GingerBot does addition

emanresu A

@taRadvylfsriksushilani You're red again

ta Radvylf srik su shilani

(My plan if it did win for some reason would be to have NP bounty it to the 2nd place person)

@cairdcoinheringaahing Aren't we allowed to vote for ourselves anyway?

I think it'd only be cheating if I got NP to do it too

Ginger Industries

I'm sure I could come up with some stupid reason for GingerBot to be nominated

emanresu A

20:40

(Not showing up in chat, shouldiblamecaching.com)

caird coinheringaahing

@taRadvylfsriksushilani Yes, but you should really avoid any and all interactions between Redwolf and NP

ta Radvylf srik su shilani

Yeah, definitely.

I'd just written six Best Of nominations and read through about 100 KotH submissions though, so I figured a little fun wouldn't be too harmful :p

And as I said, even if it did end up winning, the rep wouldn't go to me. I'd just have NP pass it on to 2nd place

emanresu A

Yeah

Adám

They say the Danes are the happiest people. I think it is because of their power sockets. All other sockets resembled faces of despair/horror/shock/etc. While the Danish sockets are naively happy:

Ginger Industries

Coade Golfer

ta Radvylf srik su shilani

20:43

But yeah, I've avoided absolutely any interactions between me and my bots. I don't even do the FA/LA reviews for them, to avoid increasing my review stats

caird coinheringaahing

These categories don't currently have any nominations: Best Explanation, Off the Charts, Underappreciated Challenge and SGITE. Additionally, Best Tip, Rookie (Challenges), Trickiest Challenge, Best Non-CG Challenge, Kansas City Shuffle and Most Improved are uncontested

9

user

@GingerIndustries Joe Unemployed

brb self-nominating myself for one of the categories without nominations :P

ta Radvylf srik su shilani

@GingerIndustries it would be difficult to hide illegal activities

caird coinheringaahing

@user Isn't that just Joe Bloggs? :P

Ginger Industries

@taRadvylfsriksushilani Bob the Burgler

Adám

20:44

Cody Coder.

ta Radvylf srik su shilani

"Jim Drugsalesman"

caird coinheringaahing

@taRadvylfsriksushilani That's pretty solid tbh

I think I may have done the FP review for JHTBot, honestly can't remember

Ginger Industries

"No, you wanted Burgler! BURGLER! I'M BOB BUGLER NOT BURGLER LET ME GO"

Adám

Tony Taxidriver.

Ginger Industries

Patricia Punmaker.

caird coinheringaahing

20:46

@taRadvylfsriksushilani Hey, I;m looking to buy some drugs, do you know someone? Yeah, just look up "Dealer" in the Yellow Pages :P

Adám

Dylan Deliveryman.

user

Wonder what people with multiple jobs would be

Montgomery McDonald's-Manager-Mailman

Ginger Industries

@user who needs resumes when you can have surnames

Adám

No family names inspired by the job of executioner?

Ginger Industries

brand new sentence!

caird coinheringaahing

20:47

@Adám Not a family name, but a band

user

@Adám There was a kid at my elementary school whose last name more or less meant "murderer." He was not very happy about it

Ginger Industries

Ridiculous things talked about in TNB #10201: Job-related surnames

emanresu A

I posted this attempting to get a sock and failing

Adám

My middle name can be spelled two different ways, and both spellings are awkward for me.

caird coinheringaahing

@Adám Spell it both and embrace the awkwardness :P

Adám

20:49

Gall Gal? Bitter girl?

caird coinheringaahing

Adám Bitter Girl Brudzewsky is a dope name :P

Adám

The legal spelling (as in my Danish passport) is Gal, which means "mad" in Danish

user

How galling

caird coinheringaahing

Adám Mad Girl Brudzewsky is even better :P

Ginger Industries

Adám "Mad Girl" Brudzewsky

caird coinheringaahing

20:51

Mad about APL, of course :P

ta Radvylf srik su shilani

Well, time to sort through 210 questions to find underappreciated ones

caird coinheringaahing

@taRadvylfsriksushilani You've got red on you

Adám

Funny enough, that has never caused me any issue whatsoever. My first name, on the other hand…

ta Radvylf srik su shilani

See y'all in like 4 hours

Ginger Industries

@taRadvylfsriksushilani redwolf murdered someone

ta Radvylf srik su shilani

20:52

(Assuming I can get about 1 per minute)

Adám

In kindergarten, children made fun of me: "adam, madam…"

Ginger Industries

@Adám what's the joke

Adám

Alliteration.

caird coinheringaahing

@Adám I had a rather ...crude joke made about my surname in Years 7/8/9

Kids can be cruel

Ginger Industries

@cairdcoinheringaahing things that rhyme with "coinheringaahing":

Adám

20:53

And, it being the normal word for person or human in Hebrew, is very confusing when people speak about certain subjects.

caird coinheringaahing

@GingerIndustries If it helps you narrow down the search, my surname doesn't rhyme with "coinheringaahing" :P

user

@Adám Oh, I thought this was going to be about the accent on your a

Adám

@cairdcoinheringaahing I don't get it. But imagine if people were talking about a specific kind of birds in your presence…

caird coinheringaahing

@Adám I mean my IRL surname, not "coinheringaahing". Can't remember if I told you what it is or not when we met

Adám

I know, and I know what your surname is, but I still don't get it.

@user Well, it was, because of its effect in Danish, but to be understood in English, it'd be just "adam madam"

caird coinheringaahing

20:56

@Adám Then you're less vulgar than 12 year olds :P

emanresu A

I imagine pxeger got teased for "Reader"

Ginger Industries

good thing that almost nothing rhymes with both "ginger" and "industries"

Adám

Finger…

Ginger Industries

@Adám nah

caird coinheringaahing

@GingerIndustries Minger (british slang for ugly)

user

20:56

Finjer

Adám

Linger…

pxeger

@emanresuA eh, not really

user

@Adám Do you pronounce the second "g" in "ginger" like the "g" in "Ganymede"?

caird coinheringaahing

@Adám I think @GingerIndustries uses a soft g in "ginger"

Ginger Industries

@cairdcoinheringaahing correct

Adám

20:58

@user No.

pxeger

@emanresuA it was mainly "oh do you read a lot" "no" awkward silence

Ginger Industries

brb

user

@pxeger Really? You seem like someone who reads a lot

caird coinheringaahing

does coding count as reading? :P

Adám

do you read what you code?

pxeger

20:59

@GingerIndustries ninja, binger, minger, singer, stinger, hinger, whinger

emanresu A

Is your code readable?

pxeger

@user well I guess I kinda do but I don't read books which is what people normally mean when they ask

caird coinheringaahing

@pxeger singer and stinger, really?

Adám

The name-calling of me wasn't serious, relatively speaking. Like, how many kids are sought after by the FBI (or equivalent) before the age of 12…

pxeger

@cairdcoinheringaahing one who singes (slightly burns); one who is stingy (not generous)

Adám

21:00

… and are still sought after 5 years later?

caird coinheringaahing

@Adám Can't imagine it's too common

user

Adám "Mad Girl" Brudzewsky, International Criminal before the age of 12 😎

Adám

I've had some interesting experiences through that, though, like sitting across from someone reading a newspaper with my image in it, and me holding up a newspaper in front of me to conceal my face :-)

caird coinheringaahing

Think I've only ever met one person who was being looked for by law enforcement, and that was in the US, being wanted in the UK for tax fraud

emanresu A

@Adám Wait what

caird coinheringaahing

21:02

@Adám ...is this actually a movie, and we're just extras for your main character?

pxeger

@Adám I don't understand what the FBI has to do with your name

emanresu A

@cairdcoinheringaahing ¯\_(ツ)_/¯ Ask mathcat, they're the director

caird coinheringaahing

@pxeger name-calling is much less important than being chased by the FBI, comparatively speaking

Adám

Sometimes I think my life would make an awesome movie… only to reconsider when I realise it'd have to be a trilogy.

Bgil Midol

CMQ: I've accidentally deleted venv in pycharm, how to restore it?

pxeger

21:04

@cairdcoinheringaahing if I remember your surname right, I can't think of any possible crude jokes about it either...

@Adám Who would direct it?

caird coinheringaahing

@pxeger @Adám Try thinking about what it would sound like if you add the UK title for men under 18 in front

emanresu A

I'm just generally confused.

Adám

@pxeger Dunno, but I'd want to be technical consultant.

@cairdcoinheringaahing Ah, got it.

Did anyone ever call you over a PA or something?

pxeger

@cairdcoinheringaahing oh I was going on your other (?) surname, but I remember that one now

caird coinheringaahing

@pxeger No idea why, but from the limited knowledge I have of Adam's life, Wes Anderson could make a good film out of it

@Adám No, but 12 year olds have endless creativity

pxeger

21:06

@Adám we don't generally have a PA system in schools in the UK

Adám

I meant like at an airport or similar.

pxeger

oh

caird coinheringaahing

Someone in my year had the surname "horne", and it was very quickly pointed out that you can pronounce that "horn-e" ಠ_ಠ

@pxeger Oh right, the spam email surname I use. Was confused for a second about "other surname" :P

pxeger

@cairdcoinheringaahing (check discord)

Fmbalbuena

@taRadvylfsriksushilani Your pfp looks like blood

user

21:09

I got teased for a full year because one kid thought it was funny to call me "yaaas" and then everybody did it

Did not help that my math teacher called me "Yeesh"

caird coinheringaahing

@user ~~yaaas queen~~

ta Radvylf srik su shilani

@Fmbalbuena Yeah. I just applied an RGB filter to the white one and didn't bother cleaning it up :p

emanresu A

I kinda want to nominate this for sgite

caird coinheringaahing

> the printer has stopped working. Please bring a hammer, a battleaxe and a potentiometer.

Yep, sounds like a typical experience fixing a printer

Fmbalbuena

@emanresuA downvote

@emanresuA Slow Good In the west?

caird coinheringaahing

21:12

Slowest Gun

Unrelated String

@taRadvylfsriksushilani did you lose the original red one

emanresu A

@cairdcoinheringaahing I'm bad at creative writing :P

user

@cairdcoinheringaahing ಠ_ಠ

ta Radvylf srik su shilani

@UnrelatedString No, but it was kinda ugly.

Unrelated String

ah

ta Radvylf srik su shilani

21:13

This one is too, but in a different way

caird coinheringaahing

@user slay!!!

Unrelated String

lmao

emanresu A

Return to browncat

Fmbalbuena

CMP: What my pfp will be changed? (Must contain APL)

user

After at least 2 seconds

ta Radvylf srik su shilani

21:22

Nearly a third of the way through going through potential underrated challenges

Currently have a list of two to nominate

Fmbalbuena

@lyxal Can you generate a random pfp with APL?

Adám

@Fmbalbuena You could use any of the logo proposals.

Fmbalbuena

@Adám I Can't find the best.

Adám

A matter of taste, but Lamp Rho Downstile Box is the most similar to what you have now.

Fmbalbuena

@Adám Show me.

Adám

21:26

aplwiki.com/wiki/APL_logo#Lamp_Rho_Downstile_Box

Fmbalbuena

Ok, i don't like.

user

I quite like Letters from the cube

caird coinheringaahing

I like Letters from the Cube, but not as a logo

ta Radvylf srik su shilani

I sat here for at least 20s wondering why so many APL logos were shaped like apples

I'm quite smart

Fmbalbuena

21:42

CMC: Print Infinite digits of Log 2 86400

first digits: 16.39874369

caird coinheringaahing

@UnrelatedString Correction, Jelly can test for squarefreeness in 4 bytes, thanks to the genius of Dennis

(maybe 5, not entire sure how this is parsed)

Yep, 5, I figured out how it is parsed :P

Adám

@taRadvylfsriksushilani I don't particularly like the pun, actually. Nested Bitmaps will win, with APL Matrix coming in second. Maybe if Lamp Box and Lamp Rho Downstile Box had been combined, they would have made a second place. I guess we'll use Nested Bitmaps in some form until Apple complains, and then switch two a non-apple logo. I'd be happy with APL Matrix or Lamp Rho Downstile Box.

emanresu A

Aight posting this

caird coinheringaahing

@emanresuA Alterantively, wait 2 hours and maximise your rep cap chances

Adám

@emanresuA Are we guaranteed that the input is rectangular/orthogonal/non-ragged?

emanresu A

21:55

@Adám Yes

Adám

Maybe say?

emanresu A

Ok

I'm pondering whether to allow taking lengths of dimensions / depth / both

Adám

This is where I need my operator to apply a function along each axis…

@emanresuA I didn't check, but did you make sure to have a test case for which going from outermost to innermost would give the wrong result?

emanresu A

CMQ: ^^^

@Adám One moment

Yes, the last test case

Adám

OK, good.

emanresu A

22:00

Opinions on allowing taking dimension lengths?

Adám

Isn't it allowed per default rules?

caird coinheringaahing

That's a default I/O I believe

ta Radvylf srik su shilani

Well, just made 7 nominations for Most Underappreciated Challenge

emanresu A

@cairdcoinheringaahing Oh 'cos C

caird coinheringaahing

10

A: Default for Code Golf: Input/Output methods

A multidimensional rectangular array may be represented by the list [dimensions, flattened array]

New Posts

22:03

0

Q: Sort every dimension

Given a multidimensional, rectangular array of nonnegative integers, sort it at every depth (lexographically), starting from the innermost. For example, with this array: [ [ [5, 1, 4], [10, 7, 21] ], [ [9, 20, 2], [4, 2, 19] ] ] You'd sort at the deepest first: [ [ [1, 4, 5], [7...

ta Radvylf srik su shilani

Which brings my total to 17 nominations written lol

caird coinheringaahing

21 seconds btw @Adám

emanresu A

Ok, when did you two start writing those?

Adám

Right now.

caird coinheringaahing

I started when you linked the sandbox, but finished and golfed after you posted :P

My only golf was ? -> ¡, which isn't especially clever

emanresu A

22:06

@taRadvylfsriksushilani ... what... why... how

Unicode?

Adám

Called it!

emanresu A

No idea what to say on that

ta Radvylf srik su shilani

If I can map arrays to strings of characters, I can abuse JS's sort...wait no, UTF-16, frick

It'd maybe work with some ... stuff, but not really worth it I guess

caird coinheringaahing

@emanresuA I take it we can assume the input will always be a list, rather than a sole integer (e.g. [1] instead of 1)

@Adám I believe you could use my approach. Instead of ×ing the depth, then checking with : and ⋄, you can apply your function (call it f) "depth" times to each element, then sort the result

Something using the power function maybe?

Adám

I'd have to call it once per depth.

caird coinheringaahing

22:16

Can you not do something like ∧(∇⍣≡)¨?

Adám

I don't see how. I don't want to sort multiple times; I want to sort at multiple depths. That's essentially what my initial solution did, but I had to write an ugly reduction because there's no operator to iterate over axes.

caird coinheringaahing

@Adám But, as sorting multiple times is redundant, you can sort multiple times at each depth if it helps save bytes

Tho, I think APL may do depth differently to Jelly

Im translating if(depth-1) {recurse each} else {sort}; sort to foreach {do(depth times) {recurse}}; sort, as recursing depth times is the same as recursing once

emanresu A

I have 9 bytes in vyxal with a different approach

caird coinheringaahing

Woah - Luis Mendo and xnor have submitted a paper based on a CGCC challenge

emanresu A

So that's what xnor's name is

@taRadvylfsriksushilani Wow, two of mine. Thanks!

Ok I have 6 in Vyxal

Adám

22:28

@cairdcoinheringaahing I still don't follow. What does "recursing N times" mean?

caird coinheringaahing

@Adám If your function is f(M), then recursing N times if f(f(f(...f(f(M)) with N calls (N=1; f(M), N=2; f(f(M))) etc.

Because calling f repeatedly on the same value has no effect, you can use the depths of each subarray to call f on each subarray that many times, as a depth of 0 (aka integers) doesn't call f

Adám

OK, I think I get it now. It'd be the same length: {∧∇¨⍣(≡⍵)⊢⍵} but fails because you can't sort a scalar.

It would be shorter in BQN, if you could sort a scalar: {∧𝕊¨⍟≡𝕩}

lyxal

I thought BQN didn't have ⍵

Adám

Fixed.

caird coinheringaahing

I'm kind of confused about how your current solution works tbh. The depth of [2, 1] is 1, so shouldn't it recuse on each of 2 and 1, so you'd end up sorting [f(2), f(1)]. Oh right, but that'd just be sorting [2, 1], I get it know

The number of times I've done ŒḊ¡ or ŒḊ?, Jelly needs a quick meaning if array, do <link>

lyxal

22:39

@emanresuA so that's what that PR fixing lazylist comparison was about :p

Adám

I think Sorting should be a no-op on scalars.

emanresu A

@lyxal ... maybe :)

caird coinheringaahing

Sorting the digits of a scalar is very useful tho

lyxal

@emanresuA no maybe about it - I remember you using what I think is a valid answer as the description of the issue you opened lol

Adám

@cairdcoinheringaahing Not in a real-world language.

caird coinheringaahing

22:43

> real-world

Adám

And what would sorting a float or character or object do?

caird coinheringaahing

Ah, there's your problem, we ignore the real world to do golfing

emanresu A

@lyxal No :P - I didn't do any example code

lyxal

@emanresuA because it was in chat lol I remember now

caird coinheringaahing

@Adám float is a no-op, character wraps to a string, object doesn't exist :P

lyxal

22:44

@Adám according to Vyxal 2.4.1, return infinity if the float is large enough (greater than 139 if I remember)

emanresu A

@lyxal Where

lyxal

Cant find it, but you linked to an example where you had a map lambda with sort inside it followed by sort

Ah nevermind

It was something similar to the challenge

But not exactly the challenge

in Vyxal, 2 days ago, by emanresu A

Uh oh...

emanresu A

That was a bug

Turned out I forgot to clone lists in comparison so it consumed the list

Wheat Wizard

It seems that the repcap ignores reputation gained from undownvotes but not from downvotes. So if you downvote something and then undownvote it is seems to up the repcap by 1. Which is odd.

caird coinheringaahing

@WheatWizard Yes but actually no. The daily rep gain shown in the dropdown is notoriously inaccurate. For stuff like that, it ends up balancing itself out over the next couple of days. You can also check codegolf.stackexchange.com/reputation and see what it reports, which is usually more accurate

New Posts

22:53

0

Q: DNA Aatch: Who did the crime?

Figure who did the crime: Suspect 1:"ATCGAAAGCACAATCATGCATCGTGCCAGTGTGTTCGTGTCATCTAGGACGGGGCCATAGGATATATAATTCAATTAAGAATACCTTATACTACTGTCCCCTGTGGTTCGAAGGGGAACTATTTCGTGGGGCGAGCCCACACCGTCTCTTCTGCGGAAGACTTAACACGTTAGGGAGGTGGAATAGTTTCGAACGATGGTTATTAATCGTGATAACGGAACGCTGTCTGGAGGATGAGTCTGACGGTGTGTGACTCGATC...

python

emanresu A

... what

Wheat Wizard

@cairdcoinheringaahing Yeah no it's not just the drop down.

caird coinheringaahing

@emanresuA Who did the crime?

SuperByte

@cairdcoinheringaahing You have to use python to figure it out

ta Radvylf srik su shilani

The problem is, there's no clearly specified way of doing that, and no scoring criterion

SuperByte

22:56

@everyone typo

there is

I just did it this morning

caird coinheringaahing

@SuperByte You realise it's currently very unclear what the question is? It looks like a programming-puzzle (maybe?) but posts that are "Figure out X from Y information, using coding" is not on topic

It might be more on topic on Puzzling.SE, but personally, I'm not entirely sure there's enough to go off to post it there

ta Radvylf srik su shilani

@SuperByte But you need to specify exactly how we should determine the DNA's similarity, and that that's what we're supposed to do in the first place.

SuperByte

You don't have to close it

ta Radvylf srik su shilani

Closing a question is done to prevent answers from being submitted while a question is being clarified

SuperByte

ok i'll edit it

ta Radvylf srik su shilani

22:59

It's not intended to be permanent, it just gives the author some time to work on improvements and gather feedback without having to worry about people posting answers that are later invalidated

I'd strongly recommend the sandbox

It lets people provide feedback on the challenge, so any issues can be worked out before posting to main. That way you know it'll be well received and easy to understand.

SuperByte

@taRadvylfsriksushilani I fixed it

You should un-close it

caird coinheringaahing

I still don't think this is even on-topic

ta Radvylf srik su shilani

It's a start, but I think it still needs some more work

caird coinheringaahing

@SuperByte What's the aim here? What should the ideal answer aim to do?

SuperByte

@cairdcoinheringaahing Who has the most dna matches in the crime scene

ta Radvylf srik su shilani

23:03

Making it so that answers should take any list of DNA segments and return the most likely suspect would be a better idea

SuperByte

Well, that is the point

ta Radvylf srik su shilani

Ah. It's worded in a way that implies you only have to worry about those three specifically.

caird coinheringaahing

@SuperByte This could be interesting, but I agree with Redwolf (@taRadvylfsriksushilani): you should post this in the Sandbox and get some feedback on it

SuperByte

Um, can you edit that for me please

@cairdcoinheringaahing the Sandbox?

ta Radvylf srik su shilani

Usually challenges will specify the task, without focusing on any input in particular, and then have a section with test cases/example inputs and outputs, like the one you have now.

541

Q: Sandbox for Proposed Challenges

This "sandbox" is a place where Code Golf users can get feedback on prospective challenges they wish to post to main. This is useful because writing a clear and fully specified challenge on your first try can be difficult, and there is a much better chance of your challenge being well received if...

discussion sandbox

3 mins ago, by ta Radvylf srik su shilani

It lets people provide feedback on the challenge, so any issues can be worked out before posting to main. That way you know it'll be well received and easy to understand.

SuperByte

23:06

k, did it

caird coinheringaahing

One suggested wording: "Given three strings of DNA of length <you choose a fixed length> representing 3 suspects, and three sample DNA segments of length <different fixed length> taken from the scene of the crime, decide which of the suspects is most likely to have committed the crime. Someone if most likely to have done the crime if the total number of matches against the samples taken is the highest of all suspects"

From that, provide a (small) worked example, and some test cases and a bit of extra backstory + explanation

SuperByte

thanks!!!

caird coinheringaahing

Oh, and I'd advise agaisnt restricting it to Python. You're very likely to get a Python answer, but there's nothing about the challenge that makes it inherently specific to the language, and it just means that other languages are arbitrarily banned

@cairdcoinheringaahing @SuperByte A few things to consider: is the DNA provided (from both the suspects and the crime scene) always going to be the same length? Does a match count overlapping matches (so does AAAAA contain 1 or 2 AAAA)? Will there always be 3 samples and 3 suspects or will it changes? etc.

Ginger Industries

23:38

hey there

oh look I made another mod

Transcript for