/dev/chat

Braiam

12:53 AM

Braiam

2:06 AM

mm... meta.stackoverflow.com/q/271998/792066

@terdon ^?

Ramesh

3:54 AM

Is there some way to tell users to be careful when approving edits?

Braiam

@Ramesh nope, but there's something in the works

Ramesh

I had to reject 2 edits today. Apparently, it was rejected by someone else as well. But I see there are similar edits that are approved by some other users.

user997112

7:53 AM

Faheem- let me know when you're online to discuss clang :)

(installing clang on Scientific Linux)

Faheem Mitha

8:04 AM

@user997112 I'm here now, but I suspect we are in different time zones.

@user997112 for the record, I don't use an RPM-based distribution. The last time was around 2001. So, I probably can't help you very much, besides giving you some obvious pointers. Have you tried talking to the llvm people about how they build their rpms?

@user997112 what is your time zone?

user997112

10:32 AM

sorry- was distracted

you still there?

terdon

Could we please push this out of the close queue? It is not a dupe:

1

Q: Getting matched fasta file

list.txt 58759__len__2903 58759__len__2903 673957__len__1655 673957__len__1655 3566454__len__1744 seq.fasta >58759__len__2903 TTTTCCGTAGAGGAGATCCCTATTTTTAGGTTTGTAAGAGATCATTTT >67777__len__2978 TTTTTAGGTTTGTAAGACCGTAGAG >673957__len__1655 CCCTATTTTTAGGTTTGTAAGGTTTGTAAGACCGTAGAG >3566454__len__...

awk

Faheem Mitha

12:01 PM

@user997112 Back again. Away again in a bit.

Well, a few minutes, probably.

Gilles

12:30 PM

2

Q: What is a relationship between Unix, Linux, Ubuntu and Debian?

I need to know: What is a relationship between Unix, Linux, Ubuntu and Debian? Are all they Operating System? I think one of them might be on top of another one. Just like DOS is on top of Windows. And DOS is an operating system. Is that relationship like this? If it is, then tell me which one is...

linux ubuntu unix debian operating-systems

wow, crappy question, crappy answers

terdon

Speaking of crap:

You found it in what log file? On what computer? What operating system? You're just showing us some random lines of text, for all we know it could be an encrypted version of your shopping list. Please edit and add more details. — terdon ♦ 21 secs ago

Gilles

I have better things to do than answer it, I'm posting this in case somebody wants to set things straight.

user1460166

1:04 PM

@terdon Hi

terdon

1:14 PM

@user1460166 Hey

I just read the answer you got. That's exactly what I had suggested but you'd said it failed!

What changed?

@user1460166?

Faheem Mitha

@user997112 i'm back again for a little bit. i'll be having dinner in 1/2 hr or so, then i'll be back here again.

@user997112 Incidentally, consider changing your user name to something people might remember. If you want them to remember you, that is.

@user997112 Have you tried contacting the LLVM folks?

@terdon "encrypted version of your shopping list". Good one.

terdon

:)

Faheem Mitha

For the rpm users here, are there generic instructions on this site (or, indeed anywhere) for building rpms from source?

terdon

Don't know, but this should help:

github.com/jordansissel/fpm

Also:

2

A: How do you separate /bin and /sbin when making an RPM?

If you want to take control of where various files will be installed you'll have to take responsibility for manually doing this within your RPM .spec file directly. Example Here's a snippet from a JBOSS RPM .spec file that I created in a blog series I wrote up a couple of years ago. The article...

Faheem Mitha

"Effing Package Management". Good name, at least.

It used to be the case that the sources and stuff had to be in specific hard-wired places on your system. Is this still the case?

@terdon I was really just looking for a list of instructions, like a cookery recipe.

As opposed to a, I don't know, bread maker or something.

terdon

1:31 PM

I know, but that's the best I have. I think the fpm docs should help though.

user1460166

@terdon you told me to source the bash file itself not the command inside it :)

@t

@terdon but thank you :)

@terdon I just have a simple question :)

I don't know why the {txtred} is sometimes working and sometimes not

in the same script

I posted a question here {txtred}

sorry :)

here : askubuntu.com/questions/527903/…

Faheem Mitha

@terdon Sure, I wasn't specifically asking you. I still can't remember if you use RH or Debian, but I think it is the latter.

/me thinks people should have their distribution of preference in their profile. It would save time. This is what is known as vital statistics.

emacs.sx has been open less than 24 hrs, and Gilles is up to 576.

This is curious. No activity, but rep is 120.

King, West Palm Beach, FL

120 2

@Braiam The point of this?

terdon

2:00 PM

@user1460166 Ah, so you added the lie sourcing the setup file? Cool .

As for the `${textred}, there's no such thing. Again, it's a variable you have defined somewhere wand will need to redefine for your script.

@FaheemMitha Me does :)

casey

2:16 PM

@FaheemMitha my preferences lie more toward package manager over distribution, as I always start with a minimal install and build upward. That said, my preferences are portage/ports, then deb, then rpm (no real experience with pacman/AUR to rank that)

slm

2:27 PM

@FaheemMitha See my A here

1

A: Centos 6.4. building rpm for cups 1.7

I would attempt to take the source RPM (SRPM) from Fedora and simply rebuild that instead of trying to rebuild it from the source tarball file. I'm not sure that the CUPS tarball comes with a usable .spec file for instructing rpmbuild on how to package it. Example You can download the F21 versi...

@FaheemMitha no you can setup a rpmbuild directory anywhere, most ppl set one up under $HOME and within there you can build RPMs from a variety stages. You can take SRRMs and rebuild them, build from spec files, or build from tarballs that have a spec file baked into them.

Faheem Mitha

2:40 PM

@terdon So you do. Mint DE.

/me wonders why everyone doesn't just use Debian.

@slm Thanks.

@slm Funny, it looks like I'm the only one to upvote that answer. So, I must have read it at some point.

casey

@FaheemMitha because debian is a good tool, but no tool is a universal solution (except duct tape)

Faheem Mitha

The poster accepted it; wonder why he didn't upvote it.

/me thinks Debian is just fine. :-)

@casey You don't know till you try. :-)

terdon

@FaheemMitha You know I haven't tried? But I am not as obsessed with free software as the Debian crowd and I like that LMDE has quite a few things tweaking out of the box. MP3 support, non-free drivers and the like. I also like the rolling release cycle and I find it cuts a nice compromise between stable and testing.

Faheem Mitha

What is so special about Mint, anyway? I like the name, as I think I've said before. Here.

terdon

@casey And blue tac!

@FaheemMitha Not much. The main version is just a better (IMO) Ubuntu. Some extra tools, some different setup scripts (better HW recognition last time I tried) but not very different. Same goes for LMDE/Debian. As far as I'm concerned, it is Debian.

casey

2:44 PM

@FaheemMitha debian is fine, for most applications. But debian doesn't compile MPI bindings into every package that supports them systemwide. That is a specialized need, but a situation where debian doesn't help

user1460166

@terdon thanks, will give it a try

:) (Y)

Faheem Mitha

@terdon Well, problems with Debian only start with free software.They can be difficult in other ways. But maintaining a SW distribution is a diffucult and thankless task, so I cut them a lot of slack.

@casey You do that in gentoo?

Yes, extensive customization is one of those things a binary distribution is bad at.

casey

@FaheemMitha absolutely. Everything that supports MPI or OpenMP has that baked in. I compile to the highest instruction set supported by my CPU so I'll have better SIMD instructions than a generic 686 binary would

Faheem Mitha

@casey as I recall you run Debian on your server(s).

casey

I run debian on a server, yes

Faheem Mitha

2:46 PM

@casey Good, I remembered correctly.

casey

that is a set-and-forget box though. I grab security updates regularly but other than that it just sits in a corner doing its work

doesn't even have a keyboard or monitor attached to it :)

Faheem Mitha

@terdon btw, the review I would up submitting yesterday was 12 pages. I have a feeling that is more than average.

@casey But super beefy hardware?

terdon

@FaheemMitha Umm. Yes, by far :)

Faheem Mitha

@terdon :-)

casey

@FaheemMitha no, my workstation outclasses the server quite a bit

Faheem Mitha

2:49 PM

@casey Oh.

@terdon I wonder whether the authors will be pleased or horrified. It's Python calling MySQL. It's a bioinformatics project. SNP data stuff. University of Pittsburgh.

terdon

Depends on what you say.

Faheem Mitha

I offered a lot of constructive criticism. :-)

terdon

I personally prefer larger reviews and appreciate it if they take the time to point out errors. Even if I disagree.

Faheem Mitha

The review was generally quite positive. I wouldn't have gone to so much trouble if I thought the sw was rubbish. Obviously.

Though it is unfortunate that everyone in academia feels the need to constantly re-invent the wheel. As I remarked in the review, in fact.

casey

@FaheemMitha server has a dual core pentium, 2GB RAM and either 500 GB or 1 TB of disk space. My workstation has a 6 core i7 990x w/HT, 24 GB RAM and 14 TB worth of disks in it

Faheem Mitha

2:52 PM

@casey What is the spec of the ws Pentium?

casey

@FaheemMitha model name : Intel(R) Pentium(R) Dual CPU E2180 @ 2.00GHz

Faheem Mitha

You don't use AMD? One problem is that Intel MBs don't support ECC memory. At least not ws class ones.

@casey Ok.

I think ECC is generally a good idea, though people don't seem to care in the consumer space.

casey

@FaheemMitha no, I source my chips from a person within intel at very favorable terms

If I were paying for them, I'd use AMD

Faheem Mitha

Not the manufacturers at least.

@casey Wow, fancy.

So you have people on the inside. :-)

terdon

@FaheemMitha I know you dislike AU but could you do me a favor and confirm this bug for me?

2

Q: The letter i is not displayed properly.

I've been meaning to post about this for a while. On my machine (LMDE, firefox, various versions) the letter i on AU is not displayed properly: You will need to zoom in a bit to see it clearly, but the i looks like this:

bug design

Or anyone else running firefox.

casey

2:55 PM

@FaheemMitha If I were buying chips and had the money to do so, I'd buy a rack and stick as many quad CPU AMD boards into as would fit, and load the boards up with the chips with the most cores.

Faheem Mitha

@terdon Sure thing. One sec.

@terdon I'm on iceweasel on wheezy. Don't see anything abnormal about the letter i on Ask Ubuntu here. I'm zoomed in to the maximum. But this is likely a more recent version.

casey

e.g. 4x16 cores per board, infiniband or something like it on the backplane Put a SAS drive array in the rack and fill up the rest with n copies of 4x16 core boards until the rack is full. <-- I wouldn't mind having that in the basement as my compute cluster

Faheem Mitha

@casey You need so much CPU?

terdon

@FaheemMitha Ah, it looks fine when zoomed it. It's only off at the default zoom.

Faheem Mitha

@terdon What is the default zoom?

terdon

3:01 PM

It really is surprisingly annoying for such a minor thing. Thanks for checking by the way.

casey

@FaheemMitha what my 6 core w/HT can do in a day, my 512 cores on Yellowstone can do in minutes.

terdon

@FaheemMitha The one you get with Ctrl+0, the one the page defaults to if you don't change it.

casey

but I only have my 512 cores on Yellowstone until next July :(

Faheem Mitha

@casey So, you want your own private supercomputer?

@casey Oh, I see.

casey

@FaheemMitha it would be private, but far from a supercomputer

Faheem Mitha

3:02 PM

@terdon I'll check again. One sec.

terdon

Thanks

casey

512 cores at home would be fun. Yellowstone has thousands of cores, 512 is just what I am allowed to allocate for my jobs.

72,288 cores to be exact

at least as of eariler this year

and its only #29 on the top500

Faheem Mitha

@terdon yes, at Ctrl 0 it is visibly shifted to the left, but it is a very subtle thing. you must have amazing eyesight.

terdon

Not really, it's just there.

Faheem Mitha

My eyesight is terrible. I had to put my face up against the monitor to see it.

terdon

3:04 PM

Thanks :)

Faheem Mitha

I mean, the dot of the i is visibly shifted to the left.

terdon

I wear glasses so I'm no hawk.

Yes, the not really was about my eyesight. I mean I can't help noticing it, it makes things blurry and it looks like an accent. I keep thinking i is í.

Faheem Mitha

@terdon Well, very correctable vision, anyway. :-) It looks like your picture, but a hundred times smaller. Should I do a screenshot and try to blow it up?

terdon

Nah, thanks, I did that already.

Faheem Mitha

Well, from the pov of confirmation.

I have version 24.8.0esr-1~deb7u1

default for wheezy. i don't really use iceweasel/firefox. what is your version?

terdon

3:06 PM

32.0

32.0~linuxmint2+betsy

Betsy?

Whatever.

Faheem Mitha

@terdon Huh. Well, I'm not surprised it is still around. You're probably the first person to notice it.

Has anyone ever reported it?

terdon

Not as far as I know. I've also only ever seen it on AU which I think uses some Ubuntu font. It looks fine on FF running in my Ubuntu VM.

Eliah Kagan

@terdon I have that version of Firefox (32.0~linuxmint2+betsy) on two LMDE systems and cannot reproduce this i-rendering bug on either. In both instances I'm using default zoom and checking both main and meta pages on AU. Am I doing something wrong, or are there other factors at work?

terdon

@EliahKagan Not that I know of. That's weird. I would assume it's something special on my setup but @FaheemMitha just confirmed it too. Do you have something nice in your ~/.fonts.conf file?

I get it on any and all AU pages, meta and main, help center, the works. Doesn't AU use an Ubuntu font?

Braiam

@terdon IMO yes

casey

3:13 PM

@terdon I can reproduce the bug on firefox 24.8.0

terdon

I seem to recall reading that. So perhaps @Eliah has it installed on his LMDE.

@casey Thanks.

casey

(yes its old, I only keep chromium on the bleeding edge)

Faheem Mitha

@terdon I didn't know there was such a thing as an Ubuntu font.

Eliah Kagan

@terdon (sry, multitasking, am checking)

casey

I can reproduce on FF 24.8.0 on gentoo. (oops, I guess that is Off-topic here, repro'd nonetheless) — casey 18 secs ago

Braiam

3:15 PM

I'm using nightly in Firefox, so I suppose my report is not as reliable

terdon

@EliahKagan no worries, take your time :)

Faheem Mitha

Another curious thing about the dot of the i in AU is that it is a different color from the rest of the font. It appears to be brown.

terdon

@Braiam But do you have the bug?

casey

@FaheemMitha subpixel hinting is likely the cause of that

terdon

@FaheemMitha It's blurred. That's what makes me think it's an antialiasing issue.

Faheem Mitha

3:16 PM

@casey @terdon oh

terdon

This is what it looks like:

casey

and afaik I have hinting turned on for everything

terdon

I made that by copying it from a zoomed in image.

Eliah Kagan

@terdon I don't think I have anything special. ~/.fonts.conf is this, on both machines.

Braiam

terdon

3:19 PM

@EliahKagan Yeah, that's pretty much what I have now. It was empty but I changed it to that in an attempt to fix this.

@Braiam So you have the same thing?

Braiam

yup

and it's only AU's font, UL i's looks fine

Eliah Kagan

Could other installed software impact this for me, even without modifying my user-specific .fonts.conf? I do have Chromium installed on both. I'm testing in Firefox, of course, but Chromium is installed ...might it have installed fonts globally? (This is an area I don't know much about.)

casey

@EliahKagan fonts are generally globally installed so every app has access to them. The differences come in how each app requests the fonts or how it substitutes fonts the system doesnt exactly have

terdon

Me neither, but I also have chromium and it works fine there so it really sounds like a FF-specific thing.

I'm thinking that Eliah has a font installed that I don't.

casey

yea, it looks fine in chromium 39

Braiam

3:23 PM

what!? Chromium doesn't mess fonts where Firefox does?

casey

@Braiam odd I know, but I turned off scaled fonts systemwide, so now chromium doesnt misbehave :)

> UbuntuRegular, Ubuntu, 'Bitstream Vera Sans', 'DejaVu Sans', Tahoma, sans-serif;

those are the font families requested by the example text in the Q

Eliah Kagan

@terdon That could be. Both machines have MATE and LXDE installed. (One of them has Cinnamon also, which I was using when I tested.) Maybe one of those DEs pulled in a font that's being used?

Braiam

btw, is holiday for those living in Christian countries

terdon

Doubt it since I'm also on Cinnamon.

Heh, that was a nice non sequitur :)

Eliah Kagan

Could something installed through the lxde metapackage have done it? (I have Cinnamon on one and not the other so that's actually the one thing I'm pretty sure it's not.)

Would the output of fc-list be helpful? (Or is there another way to list relevant information for installed system fonts?)

terdon

3:28 PM

@EliahKagan Yes please! At least I can compare that to mine.

casey

If I remove the ubuntu fonts from the stylesheet on that Q, the font rendering issue in FF goes away

so it is specifc to FF and the ubuntu fonts

terdon

Cool, makes sense.

Eliah Kagan

@terdon Here's the output of fc-list. (diff confirms it's the same on both my machines.)

terdon

Thanks, checking now

casey

font.ubuntu.com/#charset-regular

those dots on the i's and j's...

Braiam

3:34 PM

/me don't have this font:

+/usr/share/fonts/truetype/ubuntu-font-family/Ubuntu-L.ttf: Ubuntu,Ubuntu Light:style=Light,Regular

actually none of these:

+/usr/share/fonts/truetype/ubuntu-font-family/UbuntuMono-R.ttf: Ubuntu Mono:style=Regular
+/usr/share/fonts/truetype/ubuntu-font-family/Ubuntu-RI.ttf: Ubuntu:style=Italic
+/usr/share/fonts/truetype/ubuntu-font-family/Ubuntu-R.ttf: Ubuntu:style=Regular
+/usr/share/fonts/truetype/ubuntu-font-family/Ubuntu-C.ttf: Ubuntu Condensed:style=Regular
+/usr/share/fonts/truetype/ubuntu-font-family/UbuntuMono-B.ttf: Ubuntu Mono:style=Bold
+/usr/share/fonts/truetype/ubuntu-font-family/Ubuntu-MI.ttf: Ubuntu,Ubuntu Medium:style=Medium Italic,Bold Italic

casey

yea, I dont have the font installed either, but also no idea what FF is substituting for it

its not falling back to bitstream vera as when I force that override it is fine

Braiam

mm... my inspect page is broken...

Eliah Kagan

Hmm... so, while pastebinning, I noticed http://paste.linuxmint.com/ gives me http://2-old.com/. Warning: spam. That's ...bad, right? (linuxmint.com gives me the correct site. And since I get the same thing on multiple machines for the paste. subdomain, I don't think this is a local hosts file hijack or otherwise a result of me being owned. I suspect paste.linuxmint.com really goes there. Which I presume is unintended.)

Accessing paste.linuxmint.com through the Wayback Machine shows the same spammy site: https://web.archive.org/web/20140924153742/http://paste.linuxmint.com

terdon

Damn. I have all sorts of fonts installed (LaTeX y'know) so the differences are enormous. I do, however, seem to have the same Ubuntu fonts as Eliah.

Faheem Mitha

@casey Debian's tagline is The Universal Operating System. Due to Bdale Garbee, I think. But it seems to have caught on.

terdon

3:40 PM

@EliahKagan Must be offline then I guess. I get taken to the same place as you.

Eliah Kagan

@terdon Well I don't know if paste.linuxmint.com is even supposed to work. I just decided to try it and see if it hosted a pastebin. Regardless, it still shouldn't give us that site, right?

terdon

No, something is wrong. I'm guessing they never bought the domain and someone else did.

On the bright side, I seem to have fixed this. Somehow.

Figuring out the details now.

casey

@EliahKagan dig gives me paste.linuxmint.com as 208.92.233.240, which reverse as forums.linuxmint.com. Using netcat to talk directly to the webserver and ask "GET / HTTP/1.1\nHost: paste.linuxmint.com\n\n" gives me the website

no redirect

terdon

@casey How do you do that?

casey

ah, but looking at the webpage returned does look like spam

so someone either is not maintaining that site and let it get spammed to hell or someone compromised it

@terdon run nc 208.92.233.240 80 and then type GET / HTTP/1.1 <ENTER> Host: paste.linuxmint.com <ENTER> <ENTER>

you need to send the Host: header to be able to fetch anything that isnt the default vhost

and two returns to end the headers

terdon

3:46 PM

Nice!

casey

and that returned page appears to be a "vanilla" message forum

I'm not opening it with a browser though to verify

Braiam

maybe a iframe somewhere

terdon

Yay! OK, the font issue was that ~/.fonts.conf (actually, ~/.config/fontconfig/fonts.conf because the former has been deprecated) needed this section:

<match target="font">
    <edit mode="assign" name="autohint">
        <bool>true</bool>
    </edit>
</match>

So Mateo's answer on my meta Q was basically right.

Braiam

cool, there wasn't a need to restart firefox

terdon

So, thanks all for your help!

@Braiam @EliahKagan and anyone else who's affected/cares, I posted an answer explaining.

Eliah Kagan

3:56 PM

@terdon Thx!

Braiam

somehow... everything looks different...

terdon

Yeah, the font changed quite a bit.

Braiam

btw @casey, Chromium isn't respecting user preferences and doing autohint

code.google.com/p/chromium/issues/detail?id=12179

or antislashing for what matters

Eliah Kagan

@casey When I do it, it looks like HTML for the spammy page I get in a browser. Here's the text from my terminal. (That paste expires in 10 minutes to avoid doing the work of spammers and so my pastebin account doesn't itself suffer the banhammer.) For example, search for the text no-prescription. Does nc on the site give you something different?

Braiam

just way too different... it looks like chromium!

Ramesh

4:31 PM

Totally irrelevant answer even after pointing out.

Braiam

@Ramesh downvote it...

Ramesh

ha, done. I wanted to point out once before downvoting. But even after pointing out, it was totally out of context.

slm

yeah just DV this type of crap, I can't really delete it unless it's totally off the mark.

Ramesh

I am surprised that a high rep user does like this.

slm

You guys can vote to delete if I do it's gone

Ramesh

4:38 PM

I already flagged it when he made the first edit after pointing out.

slm

I do not like it and would've VtD

yeah I know I reviewed that flag and commented back to you on the flag

I was giving him a chance to try and clean up the A, if it persists then we may be able to delete later on

it would be best if he just didn't A

terdon

Yeah...

slm

it results in a lot more work for everyone

Ramesh

I added an explanation for him to either fix his answer or at least delete it.

@MohsenPahlevanzadeh, the question was about why ls | wc -l gives the word count for lines. Normally, if you do ls it is not listed in lines. We get line listing only with ls -l. So the OP wanted to know why ls | wc -l is same as ls -l | wc -l. — Ramesh 1 min ago

Faheem Mitha

"When you pipe the output of ls, you get one filename per line." Why does that happen, exactly?

Braiam

4:51 PM

this seems interesting

1

Q: Does Linux provide Predictive Self-Healing on x86?

Predictive Self Healing is a feature of the OS to predict, detect a fault with one of its components and automatically repair it. MINIX, Solaris OS and Linux on POWER all have this. But is it available in modern Linux distributions on x86 platform? Or will be?

linux x86

Faheem Mitha

Does ls "know" in this case it is not writing to a terminal?

Braiam

@FaheemMitha yes

Faheem Mitha

@Braiam How?

Braiam

reject pls unix.stackexchange.com/review/suggested-edits/62191

Ramesh

Why I cannot select custom reason for rejection?

It doesn't allow me to give my own custom as well.

Faheem Mitha

4:56 PM

@Braiam Isn't it helpful to say what exec can be used for here?

Braiam

@FaheemMitha the excerpt already says the same thing

Faheem Mitha

@Braiam Ok. custom "Repeats existing wording.". Ok?

Ramesh

@FaheemMitha it won't allow you to choose custom I guess.

Faheem Mitha

@Ramesh I just did.

Braiam

@FaheemMitha Ramesh already rejected

terdon

4:59 PM

I wonder if repeating existing wording is actually worse than having it empty...

Faheem Mitha

@Braiam Yes, I was a bit slow getting there.

@terdon yes yes yes yes

yes yes

terdon

Why so emphatic?

Braiam

@terdon he's not being emphatic, is just that Faheem keyboard has sticky keys

slm

seclists.org/oss-sec/2014/q3/649

8

God he's everywhere.

terdon

@Braiam Three of them apparently :)

slm

5:07 PM

Stephane Chazelas^^^^^^

Ramesh

yet another reason on why someone wishes to become a stephane :)

Faheem Mitha

@terdon "repeating existing wording"...

This is termed - making a point.

Braiam

@slm wonder where the heck he reported it...

Ramesh

Is too minor reason removed from edits approval?

Faheem Mitha

I didn't know that Unix code checked for kind of file descriptors. Fancier than I expected. Does POSIX have anything to say about this, or is it just some GNU enhancement?

Braiam

5:17 PM

65

Q: Approve as too minor

This is going to be pretty short and somewhat to the point. I have a big problem with what goes on in the suggested edits section of /review. Obviously there is a lot of mindless approval going on, but I think that the other big problem here is the massive amount of "too minor" edits that are sli...

feature-request status-completed review suggested-edits

slm

5:32 PM

@Ramesh IMO there are very few edits that are too minor. It just creates confusion. I'd rather ppl fix typos when they seem them and other things. Who cares if it's only 2-5 characters of change. I think that this mattered more when SO was new and they were trying to limit the churn on the system as a whole.

By that same token, don't fix 2-5 then 2-5 then tags. Do the whole edit or don't.

Braiam

@slm but, but... I sometimes discover problems after I submitted my edit :(

slm

me too

do all the editing that you can, if you miss one then do that, but strive to do them all in as few a passes as possible

Aaron Hall

5:49 PM

So I just asked my second question ever on unix SE, I'm not sure if I should accept or not. Feedback?

slm

accept if it was helpful

you are not required but having Q's w/ accepted A's makes the site more orderly and is cleaner for users that might reuse your Q down the road. They'll know that a particular A solved the problem for the OP

casey

@EliahKagan i got the same spammy page from netcat, its definitely on that site whether it is purposful or not. Might be worth a message to the webmaster about

slm

6:08 PM

@AaronHall - sorry see my comments to you above, forgot to @ your name

Braiam

6:44 PM

If you answered a question without fixing it and it gets closed, then going back and editing fixing it later is... Good. But I don't want to reward that; you had a chance to fix it before it got closed, and if you'd done that you'd have saved a whole heap of people a lot of time and effort... So that's the behavior we're looking to reward here. — Shog9 ♦ 9 mins ago

that's what people don't understand... and get mad because the question they answered got deleted

200_success

Has anyone seen this bash exploit, credited to @StéphaneChazelas?

Seth

in Ask Ubuntu General Room, 53 mins ago, by jrg

Update bash right now. It has a remote code execution vulnerability. sudo apt-get update && sudo apt-get dist-upgrade

in Ask Ubuntu General Room, 47 mins ago, by terdon

Yay! It was discovered by one of the two top users of U&L :)

We saw it :)

Braiam

@200_success yeah, some time ago @slm posted it

terdon

2 hours ago, by slm

http://seclists.org/oss-sec/2014/q3/649

slm

7:02 PM

on your 6 boss

Eliah Kagan

@casey I've now emailed them about it -- thanks!

Braiam

8:13 PM

where's Stephane when you need it? unix.stackexchange.com/q/157329/41104

Braiam

10:54 PM

@Gilles also @terdon and @slm meta.stackexchange.com/a/239950/213575

terdon

Nice!

Braiam

why are we migrating this? unix.stackexchange.com/review/close/62184

terdon

No idea. Looks fine to me.

Took care of it.

Braiam

@Anton why were you migrating ^?

Gilles

11:15 PM

@StéphaneChazelas Badly-formed definitions aren't the only problem with bash's function export feature. echo='() { builtin echo pwned; }' bash -c 'echo hello'

Stéphane Chazelas

11:45 PM

@Gilles, that's only if you can pass env vars with any name, then, you can also pass PATH. Here it's env vars whose content have a given pattern which is another issue altogether. Note that sudo blocks env vars that start with "()".

Gilles

11:56 PM

@StéphaneChazelas Yes, but with most shells, you're safe if you blacklist some known variable names, and you can establish a known environment at the start of the script. With bash, you absolutely need to whitelist before the script starts.

Transcript for