« first day (3214 days earlier)   

12:43 AM
@terdon I'm in total agreement. I feel guilty closing an 14.04 or 18.10 question when the same problem might exist in 18.04 or 16.04. And the same solution would apply to all versions. Even Linux Mint I'll look the other way and not initiate close voting if it's a kernel problem or driver issue. Once initiated by someone else though I have to vote along because it's procedure / protocol / politically correct.
 
1:04 AM
0
Q: hiDPI scaling fix for Davinci Resolve 16 in Gnome

Hans JI asked a similar question about hiDPI scaling here. This question regards fixing scaling on a specific application, the other question is about a universal hiDPI mode. I am running ubuntu derivative Pop!_OS 19.04 in Gnome I built a .deb package for DaVinci Resolve 16 with MakeResolveDeb and it...

 
 
5 hours later…
6:19 AM
@WinEunuuchs2Unix oh if I can get away with it I will just remove mint or version tags :-)
 
6:37 AM
systemd strikes again: phoronix.com/… AMD Ryzen 7 3700X + Ryzen 9 3900X crash during installation due to systemd crashing
 
 
1 hour later…
7:46 AM
0
Q: Ubuntu Server Installation media boots to weird installation menu

AmpckThis is probably a noob question so sorry in advance! When I boot the Ubuntu Server installation disk, It boots to this weird screen with a ton of green "OK's" and text instead of the typical installation screen: https://tutorials.ubuntu.com/es6-bundled/src/codelabs/tutorial-install-ubuntu-serve...

 
8:26 AM
0
Q: I broke my Alt-drag windows feature on Ubuntu MATE 18.04

KlaymenDKI just installed Ubuntu 18.04 MATE, and while fiddling with it and installing a ton of apps and configuration that I need for work, somehow I managed to make it so Alt-click-and-drag no longer moves a window (and Alt-rightclick no longer resizes it). I would very much like to restore that functi...

 
 
2 hours later…
10:46 AM
0
Q: Docker service not starting on new WSL2

CosmicSageIm trying to start docker in the brand new WSL2 with the following command : sudo service docker start then: sudo service docker status result : * Docker is running BUT on running the test container with : sudo docker run hello-world Error:docker: Cannot connect to the Docker daemon at ...

 
 
1 hour later…
12:06 PM
0
Q: Histogram with FASTA file

Max MustermannI am new to Linux. I have a FASTA file that looks something like this: >scaffold1 AAGACATAATATTTTGGAGGAATTAAAAAATTTAAGATGTATTTTATTATACATGTATTTTATTTATAACATAAATAAACATCCCAAGGAAAAGCAGTAGCT >scaffold2 AAGGATAAGTGTAGCTGAGGAATTAAAAAATTTAACAAATAAAATTAATGCAATTTATTTTTTCAAATAAAAATACACGGAGAAAAATAATTTGTAAATT...

 
 
2 hours later…
2:26 PM
0
Q: Access Ubuntu desktop remotely from Mac OS

karlkI would like to be able to access my Ubuntu 18.04 desktop (not just terminal) from Mac OS (Mojave), and have tried a couple solutions, with less-then-desirable results: Installing google chrome remote desktop caused terminal to not launch properly. XRDP would only display a blank screen on the ...

 

« first day (3214 days earlier)