The 2nd Monitor

syb0rg

6:00 PM

@EBrown You'll soon be starred

2

EBrown

@syb0rg Noty.

2

syb0rg

Maybe they ran out

2

EBrown

Man, Spotify really torques me off.

2

Many of the songs I like they keep removing and saying "This track is not available in your country."

2

ardaozkal

what the star

2 hours ago, 1 hour 33 minutes total – 18 messages, 6 users, 18 stars

Bookmarked just now by ardaozkal

Captain Obvious

0

Q: Data analysis pipeline

I'm reading in files in the following format: SN971:Xap108:1:1101:10.00:1067.90:0:1 MOUSE_chr1 95333658 95333666 + MOUSE_chr1 95302516 95375494 GENE:Hdlbp ACC:NM_133808 - CCCTCCCACCACGCCCGGCG BC:CCCTCCCACCAC UMI:GCCCGGCG FEAT:CODI...

python

EBrown

6:04 PM

@ardaozkal >.>

Michael Brandon Morris

@ardaozkal I'm out now.

EBrown

At least they didn't remove my Jethro Tull.

WHAT

THEY GOT RID OF ELECTRIC AVENUE?

I'm done with Spotify.

Jeroen Vannevel

I guess it's

Avenue unplugged

EBrown

-1/10

That was bad.

Jeroen Vannevel

it was amazing

EBrown

6:11 PM

Just horrible.

So bad.

Jeroen Vannevel

jealous you didn't come up with it

EBrown

No, I'm actually feeling sorry for you right now.

I'm disappointed you actually thought that was any good.

ardaozkal

@EBrown I'd get rid of it too

but I can't :/ paid early

EBrown

@ardaozkal I haven't. :)

I have to check out Groove Music and see how it compares.

All my Taylor Swift music got removed

2

I guess I can keep Spotify.

ardaozkal

well I increased my mobile pack and am paying 10tl more every month, I got extra 3gb and 1000 worldwide minutes and free 1 year spotify premium.

EBrown

6:13 PM

Ah.

I have payed for it for years.

ardaozkal

the ads suck

EBrown

Yeah.

That's why I bought it.

Captain Obvious

0

Q: PyCharm won't work

print "Hello Ara" That's all I want to do. When I open the edit configuration window there is an error message, Please select a valid Python interpreter. I don't really know what this means. In the python interpreter pulldown menu the only option is Project Default (none). (I downloaded ...

python python-2.7

EBrown

LOL

ardaozkal

til: EBrown is Daniel Ek

EBrown

6:15 PM

Who?

syb0rg

@CaptainObvious That sounds on topic....

EBrown

All my Hootie and the Blowfish songs are gone.

Spotify get out of my life.

@ardaozkal LOL

Nah, he's 12 years older than me.

CCR is still here, I suppose it's alright.

That screenshot is hilarious.

A_S00

...but do they have Garbage, or has it been removed?

Mat's Mug

I'm only happy when it rains

great, now I have garbage playing in my head

EBrown

6:32 PM

LOL

I have "Never Been Any Reason" stuck in mine.

I've had it for days.

Captain Obvious

0

Q: Javascript / JQuery Memory Guessing Game

Hey I would love some code review for my Javascript / JQuery Memory Guessing Game. Link: http://codepen.io/AlonBukai/pen/NrNEyG

javascript jquery

EBrown

@Mat'sMug @Zak support.office.com/en-us/article/…

> Hyperlinks in a worksheet: 66,530 hyperlinks

Seems like a weird limit.

Mat's Mug

off-by-five is a thing y'know

EBrown

That's not off-by-five.

Mat's Mug

lol

EBrown

6:41 PM

Look at the number: 66,530.

Mat's Mug

off-by-995 is a thing y'know

EBrown

You're thinking 65,536/65,535, but this is 995 more than that. Lol

Captain Obvious

0

Q: Hardest Guessing Game Ever Python 2.7.11

`from random import randint from sys import exit ans = randint(0, 1000) guess = int(raw_input("Guess a number between 0 t0 1000:")) if guess == ans and guess.isalnum: print "Great Job! You won the Hardest Guessing Game ever!" elif guess != ans: print "Good try. Try and guess again." exit(...

python python-2.7

ardaozkal

@CaptainObvious I can make harder

randint(0, 2147683545)

syb0rg

randint(-sys.maxsize, sys.maxsize)

ardaozkal

6:57 PM

@syb0rg better

why int tho?

Lets use float to make it harder

Mat's Mug

> Guess the number
> 2
>
> Wrong. The number was 1.999999999997

5

Dan Pantry

@EBrown my favourite part is that they don't tell you it has been removed. Its just silently removed until the next time you want to lisetn to it.

Any EF users here? Need opinion on pattern usage

Mat's Mug

hides

@DanPantry is that the apple thing?

Dan Pantry

@Mat'sMug Spotify

@Mat'sMug Let me whip up a comparative review gist

syb0rg

@ardaozkal random.uniform(-sys.maxsize, sys.maxsize)

Good bloody luck guessing that

Mat's Mug

7:00 PM

IDK, I'm old school. I buy CD's and no apple steals my music off my computer and then makes me pay to listen to it.

ardaozkal

while true
      raw_input("I picked a number between -33746852638527234658234658234658435628 and 33746852638527234658234658234658435628")
      echo "Wrong, try another number."

oh wait its python

Dan Pantry

@Mat'sMug gist.github.com/danpantry/3b82e882594b7ed734cda096d697dc3d

Latter is what we have now, former is what I think is probably the better option

Previously DbContext was thread-scoped, which I believe leads to bad practices (for one, it assumes that all connections have their own thread, which for IIS is true but Project Katana is completely false)

...What's happening to me... I'm caring about a strongly typed language.....

Also, first "Cons" in repositoryishpattern should be "Pros".

syb0rg

@CaptainObvious You almost snuck past me

Mat's Mug

Shouldn't DbContext live in request scope?

Dan Pantry

@Mat'sMug I was under the impression DbContext should be created for one unit of work

So, for example, creating an appointment would be a unit of work because it is one transaction

ardaozkal

7:11 PM

< unless my guesses of who will win the elections are correct, I'll be a pony for a month.

Mat's Mug

Didn't look at the gist yet... but I assume you have the DbContext wrapped with a simple IUnitOfWork interface and constructor-injected such that the IoC container controls the context's lifestyle

Dan Pantry

@Mat'sMug uhh.. that's the latter, yes.

and what we have now.

The issue is that falls down when you have something that requires transactional behaviour (like modifying two things at once)

Maybe that's a problem with our current architecture, though.

Mat's Mug

It does assume one transaction per request..

Dan Pantry

@Mat'sMug Yes, but if both service A and service B require a dbcontext, even if they are the same db context, they will both execute SaveChanges at different times, thus B can fail while A succeeds even though it should be in a transaction

Mat's Mug

wait a sec, so you have service A doing thing A and service B doing thing B, and both thing A and thing B need to be in the same transaction?

Dan Pantry

7:21 PM

(Y)

Now you see the problem, which is why I am thinking that our services are doing too much

And that the real solution lies in between the two approaches

sticking with DbContext being injected but moving more stuff to a factory or something

If you look at the gist it will become clear: Our schema is absolute rubbish. Creating an appointment requires creating an entry in the Appointment table but also the Calendar or History table depending on a set of criteria

Modifying the schema would be a good idea but it's not possible now for backwards compatibility reasons

Mat's Mug

why would service A call into service B?

Dan Pantry

Because the way the app is currently architected is such that service B is doing some work and service A is doing some work instead of service A/B not doing any work (and just saving stuff to a DB)

Mat's Mug

        dbContext.Appointments.Add(model);
        dbContext.CalendarEvents.Add(CreateCalendarEventForAppointment(model));
        dbContext.SaveChanges();

this looks right to me

Dan Pantry

Yes, we don't have that.

We have the secnod model

So the real answer is a mix of both sections

Mat's Mug

let the calendar service do its thing, and have the appointment service do its thing - the two are separate things that shouldn't know about each other IMO

Dan Pantry

7:26 PM

I guess this is why they say software is hard. it's easy to write code, it's hard to write good code.

ardaozkal

Dan Pantry

@Mat'sMug Well, creating an appointment necessarily means creating a calendar item... with properties of the appointment. So at the very least, I'd need another "layer" above those services.

They should not have anything to do with each other, but if either fails, the other needs to be rolled back due to the nature of the schema.

Mat's Mug

or, make an overload in the appointment service, like

void Add(DbContext,CalendarEvent)

so the appointment service can call the calendar service and pass the transaction along with its request

Dan Pantry

Feels like a hack, but I don't think I'm getting any clean solutions with this

Mat's Mug

it feels like a hack because it's not constructor injection... but it's dependency injection nonetheless. via a method parameter.

Dan Pantry

7:31 PM

Well, it feels like a hack because what that achieves is code re-use (which is what I'm trying to do) without breaking transactional purity

Maybe a better idea would be to refactor the logic of the Add method (in all but actually interacting with the dbcontext) into a separate class

Mat's Mug

constructor injection is the preferred way of injecting dependencies. it's not the only way to do it

yes

Dan Pantry

@Mat'sMug I agree, it seems my choices are method injection (which feels dirty) or refactoring logic out

Mat's Mug

void Add(CalendarEvent calendarEvent)

Dan Pantry

I feel really uneasy about the current solution simply because it depends on DbContext being thread-local in order to save changes atomically, so anything is better than that

Mat's Mug

^ this one should call Add(_context, calendarEvent)

software is like a work of art: it's never really "done".

...and most of the time it's "beautiful" only when you look at it in a crooked way

or if you're @rolfl

hey @rolfl :)

syb0rg

7:36 PM

Hello @rolfl

Finally some on-topic questions are being asked

Captain Obvious

1

Q: An interesting use of the reduce function to convert tab-delimited data into JSON

The data: Marry Poppins red bicycle 80 2 Marry Poppins glass vase 20 8 Abe Lincoln gold ring 1 100 Marry Poppins umbrella 5 50 Steve Rogers video camera 1 100 Abe Lincoln president chair 1 1000 Marry Poppins blue dress 2 200 The function: var fs = require('fs'...

javascript node.js functional-programming json

0

Q: Can I simplify with Higher Order Functions?

I am working my way through FreeCodeCamp's Javascript challenges and this one took me a minute. In this one the goal was to create an array with the highest values from each array as its elements. I am currently using for loops to iterate through the various arrays and arrays of arrays. I wante...

javascript programming-challenge functional-programming

RoboSanta

8:00 PM

Ripe zombie; open question with answers, at least one answer having score 0, no answer having score > 0: Image downloader class c++ network-file-transfer qt

Captain Obvious

0

Q: AsyncCommand using MVVM and WPF

Goals I want to be able to call async code using the MVVM pattern I want to be able to add loading animations/screens without having to add properties for each command on my viewmodels I may want to be able to cancel these operations This is what I came up with public abstract class Command...

c# wpf mvvm

Captain Obvious

8:20 PM

0

Q: Countable and uncountable sets in .NET (clean version)

Sorry, it used to be some retired garbage in Countable and uncountable sets. Now and here it is clean. P.S. I would not like to say that this stuff is about to replace functional programming :) No, it is just about predicates becoming a full featured objects, so you can do math on them in the f...

c# set ddd

Duga

You really should use PHP's built-in functions to handle password security. Make sure that you don't escape passwords or use any other cleansing mechanism on them before hashing. Doing so changes the password and causes unnecessary additional coding. — Jay Blanchard 53 secs ago

Dan Pantry

@Mat'sMug I worked out the problem with my architecture

appointment + calendar item shouldn't really be linked, right?

ilke an appointment can exist on it's own

surely, then, either the DB or the client should orchestrate that interaction

I realised that when I realised there was another interaction like that in our app: creating a query could allow you to create your own contact at the time

currently, the service creates the contact for you based on a string (0 | number | string)

really, the client should create that contact and then submit the query

Duga

You might want to check out Code Review. Stack Overflow is better for fixing broken code, not improving working code. — Mike C 38 secs ago

Dan Pantry

i mean, if the server is just an apis erver it should not care about the abstractions of the client, and that's where I've been going wrong

skiwi

Just delete all, (leave the place) and rebuild

Dan Pantry

8:38 PM

This kills the project @skiwi

Quill

monking

ardaozkal

@Quill morning

Mast

Monking

My clipboard is on the fritz...

skiwi

Yay, interesting Rust stuff again

#[inline]
fn get_unchecked(&self, index: usize) -> bool {
    let (data_index, remainder) = self.compute_data_index_and_remainder(index);
    let element = unsafe { *self.pointer.offset(data_index as isize) };
    (element & (S::one() << remainder)) != S::zero()
}

Duga

8:54 PM

I asked 2 question here because I thought they might be related, one is putting x in missing and one is copying from row in missing.Also the next problem is more of "how to improve" like rather than "what is solution". So can can I ask it here in SO or I have to ask it code review? — Eular 56 secs ago

@SergeyA I think it depends on how mired in the dark ages your code reviewer is. It is a known and designed-in feature of shared_ptr, because the deleter is carried with the shared control block. Anyone who does not realise this has no business reviewing code. Furthermore, any modern (i.e. less than 10 years old) compiler will warn when virtual destructors are required but not declared. — Richard Hodges 57 secs ago

syb0rg

One more vote needed to reopen (if you deem it so): codereview.stackexchange.com/q/131949/27623

Mast

Yuck, C# boilerplate.

Duga

9:16 PM

From your description, it sounds like this question might be a better fit for Code Review. — John1024 38 secs ago

Mat's Mug

@RubberDuck TIL nulling a Collection reference that contains thousands upon thousands of object references apparently does not cause a memory leak.

Just tested both with adding 1024 x New Class1 references in a tight loop, monitoring the EXCEL.EXE process in task manager; it seems the memory leak is a story to scare kids when it's late - nulling the reference does the job. — Mat's Mug 32 mins ago

3

Just deleted an upvoted SO answer based on that finding

rolfl

9:26 PM

Monking

Mat's Mug

Hail!

♪ Haaaaail to the kiiiiiiiiiing ♪

rolfl

gurumble....

Mat's Mug

been a while @rolfl, what have you been up to?

rolfl

So busy at work and home I have no time for fun.

Still building a whole new datacenter and control point.

You know, I was about to have a nap..... and I think I still will.

Mat's Mug

aw.. we're missing a java snakes & ladders entry :)

Dan Pantry

9:36 PM

it's still stuck in the AbstractBoardGameFactory ;-)

Duga

If your code works as intended and you've tested it and you want to know if it could be implemented better, or improved in any way, you should head over to Code Review. If there's no specific problem with your code, the question is off-topic for Stack Overflow. — Mat's Mug 1 min ago

possible answer invalidation by Jamal on question by nakamin: codereview.stackexchange.com/posts/132001/revisions

Captain Obvious

9:52 PM

0

Q: Render SVG background with Gradient

I'm new to and still fairly confounded by SVGs. So feeling pretty happy with the following hobbled together SCSS code demonstrated here. //Functions to create svg backgrounds: @function _buildSVG($bg, $width:'100%', $height:'100%', $viewboxx:'0', $viewboxy:'0', $viewboxw:'274', $viewboxh:'510'...

sass

Quill

@Mat'sMug feel free to write one

Mat's Mug

I'll make one in Excel-VBA before I go through the pain of making a JAVA one. Because yes, it would be JAVA and not Java. I know me.

3

skiwi

Whoops just figured out after mentally debugging my bit vector that I could not set a bit to false anymore once it had been set to true

Captain Obvious

-2

Q: How do I add multiple enemies trying to attack my character? (also how do i make him shoot projectiles to defend himself)

import pygame import time import random pygame.init() white = (255,255,255) black = (0,0,0) red = (255,0,0) green = (0,155,0) display_width = 900 display_height = 700 gameDisplay = pygame.display.set_mode((display_width,display_height)) pygame.display.set_caption("I'll think of a name later"...

python pygame

ardaozkal

@Quill you're a mod now? congrats

I suppose protemp as only Arqade had elections lately

Ahh, You're a protemp on language learning congrats

Mat's Mug

10:07 PM

hey look who's blue! congrats @Quill!

Jamal

Enjoy those chat flags. ;-)

Mat's Mug

I guess we'll see you in TL :)

Quill

I already play with chat flags ;)

thanks guys :)

Captain Obvious

0

Q: Project Euler #49 Prime permutations

Today I tried solving problem #49 from project euler .net which reads : The arithmetic sequence, 1487, 4817, 8147, in which each of the terms increases by 3330, is unusual in two ways: (i) each of the three terms are prime, and, (ii) each of the 4-digit numbers are permutations of one anothe...

c# programming-challenge

RubberDuck

10:26 PM

@Mat'sMug who ever said it did? It's an urban legend caused by someone who once didn't implement a COM library correctly. The real memory leak problem is with circular references. Avoid circular references and you're fine.

Mat's Mug

I said it. ...then I deleted my answer.

3

RubberDuck

Btw grats @Quill! And good to see you stop by @rolfl

Lol

Mat's Mug

TTQW

RubberDuck

Oh. Btw^2: Pointers in C# are a PITA

I've no idea if I'm properly freeing memory or not...

SirPython

Congrats @Quill!

skiwi

10:36 PM

Grats @Quill I did see your blue name but didn't realise you were a mod til now ;)

Quill

nah, I'm not actually a mod, I just modified all of my userscripts to set my name to blue. chances are you probably have at least one installed

ardaozkal

one is by you but I forgot which

Jamal

I'm gonna pimp this one-away question, which is also my firs "JAVA" question.

Quill

@ardaozkal the first and last

ardaozkal

thinking of it, why do I even have popcornse enabled? It doesn't work for >10k or on Firefox. or both.

Quill

10:46 PM

yeah, somehow firefox installs are borked... I really need to take a look at those

ardaozkal

You should use firefox anyways. Chrome is too cpu-hungry and I don't really like having everything synced with google (chromium is better).

Quill

I might start using Safari... they have ES6 full compliance too

ardaozkal

isn't safari on windows discontinued?

or are you on mac?

Quill

Mac, mostly

ardaozkal

Ah.

I used to use Edge but hopped to Chrome for adblock and lastpass and switched to firefox for reasons above and the fact that I can sync data between pc and phone (like in chrome), and the phone version support extensions.

Quill

10:58 PM

Okay. iPhone has handoff which supports Firefox and Chrome, so I didn't really need to use Chrome on mobile, which is cool

Captain Obvious

11:10 PM

1

Q: finding the prime factors of positive number in c

I have an assignment to write on the standard output, the prime factors of a positive number displayed in ascending order and separated by '*'. my code works, I need help reviewing it, before I submit my work. Allowed functions: write. #include <unistd.h> void my_putchar(char c) { write(1,

c

0

Q: Codewars "Find the Parity Outlier" code

I completed this Codewars exercise. Here are the instructions: You are given an array (which will have a length of at least 3, but could be very large) containing integers. The integers in the array are either entirely odd or entirely even except for a single integer N. Write a method ...

python python-2.7

Captain Obvious

11:31 PM

0

Q: Swift: Encoded Image pass to server

let theImg = imageview.image! let imgrep = UIImageJPEGRepresentation(theImg, 0.5) let b64 = imgrep!.base64EncodedStringWithOptions(NSDataBase64EncodingOptions.Encoding64CharacterLineLength) let replaced = b64.stringByReplacingOccurrencesOfString("+", withString: "%2b") I want t...

ios swift

Captain Obvious

11:51 PM

0

Q: Pig Latin converter in Python

How is it and can it be optimised? sentence = input("Enter a sentence you want to convert to pig latin: ") sentence = sentence.split() for i in range(len(sentence)): if sentence[i][0] in "aeiou": sentence[i] += 'yay' else: sentence[i]=sentence[i][1:]+sentence[i][0] ...

python performance pig-latin

what the star

Transcript for