/dev/chat - 2014-03-07 (page 2 of 2)

« first day (1245 days earlier) ← previous day next day → last day (3692 days later) »

4:01 PM

I hadn't seen this technique before using stap to get a file's creation date from an ext4 filesystem. Might be of interest to others here, that it is possible.

3

A: How to find creation date of file?

TLDR; Use stap ("SystemTap") to create your own kernel API. Demo of ext4 creation time extraction below. You can extract the ext4 creation times on Fedora 19 systems. Here's mine: $ uname -a Linux steelers.net 3.11.1-200.fc19.i686.PAE #1 SMP Sat Sep 14 15:20:42 UTC 2013 i686 i686 i386 GNU/Li...

@FaheemMitha Hi again - do you want to discuss here or in a separate room?

@assylias I think the main room is reasonable. Unless anyone objects. That way other people might have something to say.

@assylias I'm not sure what is going on with your system. The output looks normal.

that is a problem - I've tried reinstalling each package manually with aptitude

Does anyone object to possible clutter from pasting stuff here and so forth? If so, we can move to a private room.

but most of the time it decides to "keep current version", which happens to be "uninstalled"...

4:06 PM

@assylias first diagnose the problem, then fix it. doing random stuff isn't a good approach. and if something works, you don't know why.

that is the story of my day so far! ;-)

what do you suggest I did next to trouble shoot the situation?

Ok, one sec. I'm looking at a couple of things. Anyone else interested in troubleshooting here?

I noticed that in aptitude, when trying to install gnome, I get a warning: "WARNING: This version of gnome is from an untrusted source" etc. Could I be pointing to a wrong repository?

@assylias Possibly, but the version of gnome listed in apt-cache policy is from an official site.

Can you also post the output of apt-cache policy (just that) in the question? It is a bit verbose.

This all looks normal so far. can anyone think of anything I am missing?

I've added that to the question

4:15 PM

The kinds of error messages you are seeing are usually the outcome of screwy priorities and/or mixing packages from different distributions. Is this pretty much a vanilla wheezy install, or do you have third-party or testing/unstable packages in there?

mostly vanilla - I also use mongoDB / postgreSQL repos but I don't think it is related. And everything worked fine before I added / then removed the backports repo and failed to install an application (things started to be messy after the failed installation)

@assylias What app was that?

xmbc

You might want to take out the http://www.deb-multimedia.org/ lines. The maintainer can't be bothered to be debian-compatible, and it is frequently a source of problems. run apt-get update, see if it makes any difference. Long shot.

I followed the instructions here: To install Frodo 12.3 on Wheezy you will need to enable wheezy-backports..

ok will try

4:18 PM

what does dpkg -l and apt-cache policy give for xmbc?

you can just comment them out

the deb-multimedia stuff i mean

~$ sudo apt-cache policy xbmc
xbmc:
Installed: (none)
Candidate: 4:13.0~alpha11-dmo3
Version table:
4:13.0~alpha11-dmo3 0
500 http://www.deb-multimedia.org/ testing/main amd64 Packages
2:11.0~git20120510.82388d5-1 0
500 http://ftp.uk.debian.org/debian/ wheezy/main amd64 Packages

@assylias yes, the instructions are fine.

hmm, were you trying to install from deb-multimedia?

I don't know to be honest - possible

I just used "Force version" in synaptic to point to version 12.3 but the installation failed (Broken package if I remember well)

@assylias ok, force anything is generally not a good idea.

@slm unix.stackexchange.com/a/118428/33055 more funny comments

4:21 PM

I've learnt that today it seems!

if taking out the deb-multimedia lines don't work, try taking out all the other third party lines

pg and mongodb i guess

do you have a non-empty /etc/apt/preferences? Is there anything in /etc/apt/preferences.d?

you can check whether you have some unexpected third party stuff by running apt-show-versions.

preferences.d empty

no preferences file

@Anthon that guy doesn't seem to get it

Hallelujah!!

removed both deb-multimedia and team-xbmc-xx and it apt-get install gnome works!

feel free to post as a short answer to the original question

@assylias Ok, will do.

But first, i'd like to clarify a couple of things.

What is team-xbmc-xx?

4:36 PM

I suppose it is a repository that I included to download a previous version of xbmc

i don't see that in the sources list. is that a package?

it was not in the sources.list but in the sources.list.d directory as a separate file

@assylias Hmm. Should still appear in apt-get policy

what did the line look like?

oh right - file was empty anyway

so it's only deb-multimedia that was causing problems I suppose

Ok, so the problem was deb-multimedia then

4:38 PM

content was "deb deb-multimedia.org testing main non-free"

yes apparently

Ok, just a note. If you are putting in third party repositories, pin them so they don't interfere with normal installation.

i find 50 mostly works ok.

pin = give lower priority?

Though maybe 1 would be better.

@assylias right, you want to stick them at a lower priority.

ok makes sense - thanks for the tup

tip

i generally put debian testing/unstable at 50, if i am running stable, which i usually am

non-debian third party repos i guess 1 is ok

wheezy-backports does not require special treatment i think

4:41 PM

ok

they do their own pinning upstream

yes, looks like at 100

Ok, will post a brief answer. one sec

whenever - thanks again.

@assylias Ok, done now. My pleasure.

@FaheemMitha Yeah, that graph works in Chromium 32. And Firefox (Iceweasel actually) 27. I drag over it, and it shows the range I picked.

@casey no he doesn't. Thanks for the upvotes (assuming they were yours)

4:50 PM

@assylias Do you want me to remove my comments to your question?

@derobert I'm running 32 on wheezy. Doesn't work for me.

Not sure - they may help somebody troubleshoot something similar - you may leave the most important ones. (although the real work was in the chat!)

@assylias Ok, I'll leave them.

@FaheemMitha You have to drag over the graph, not the dates labeling it... maybe thats it?

if you want me to remove any specific one, let me know.

@derobert the bottom graph, right?

yeah

4:53 PM

@derobert Nah, i tried different things, including that.

You can probably remove them all but the first one and the second to last.

@FaheemMitha hmmm... will send a video... once YouTube finishes...

"This is taking longer than expected. Your video has been queued and will be processed as soon as possible." ... ugh

@assylias Done.

@derobert Thanks, you didn't have to go to so much trouble.

@assylias i added a link to chat. supposedly chat is permanent.

i have mixed feelings about that. if one day i fly off the handle on chat, my ravings will be preserved for posterity...

The secret is to remember to delete your insane ravings within the several minute window.

@assylias i see you have a high rep on SO, but no presence here, really. Not a big *nix user, I suppose?

5:01 PM

and I let the hell broke loose in meta.AU

@derobert It's only 3 minutes. That is scarcely enough time to get a good rave on.

@FaheemMitha No - unfortunately I live in a world where most applications don't have a linux version!

@assylias Well, that's too bad. It happens.

:-)

@Braiam Do tell.

5:04 PM

@FaheemMitha ?

@Braiam about the hell breaking loose.

ah, just follow comments on opening the migration paths

@Braiam we're lazy... links please!

@BrunoPereira then, you don't trust the community that selected you as moderator to moderate the site? That's the only way it can be read. — Braiam 7 mins ago

I expect a major event after that comment

@Braiam major?

5:11 PM

@FaheemMitha big

@derobert Thanks.

@Braiam ... how messed up is AU?

Reading through that meta Q, it sounds like they ought to nuke the site from orbit...

@derobert That highlighting thing you are doing does not work.

@derobert harsh

@derobert if they got rid of the site, all those people would come here. do you really want that?

@FaheemMitha Well, I assumed nuking it would take the people out too. I mean, nukes aren't known for being very people friendly!

We'd have to declare Ubuntu off-topic...

@FaheemMitha Hmmm, I guess you get to try sans extensions, etc.

5:20 PM

@derobert Ooh, aggressive. You'd take out @Braiam too, then. Plus other unix.sx regulars.

@derobert Does this use js i wonder?

@FaheemMitha We'd let them know in advance, and presumably they'd be smart enough not to visit AU that day

@FaheemMitha Probably.

@derobert Fair enough.

@assylias stop by anytime.

But honestly, I wonder how much stuff would actually be migrated if they enabled it? Especially if they worded it like it is on SO.

@derobert Don't follow the second sentence.

On SO, when you close a question as off-topic, there are site-specific close reasons... the first two are ask your question on SuperUser and ask your question on Serverfault. Those don't migrate. Only if you click belongs on another SE site, and then select one does it migrate.

5:25 PM

@derobert I see. Why don't they migrate to SU and SF?

@FaheemMitha Those are what you do with crap off-topic questions. Just close them.

Only for good off-topic questions do you consider migrating

@derobert I see.

So as not to make it easy for the crappy question.

Reducing migrations from SO was a priority for the other sites, because SO is huge. Much, much, much larger than SF, for example. They were getting sick of all the bad questions being migrated from SO.

@derobert That makes sense.

user image

that's what it looks like

5:34 PM

@derobert see terdon answer for some examples of good questions that were closed in AU due being Debian, Mint, etc. ;)

Do others think this Q is really a dup?

2

Q: How are system commands like ls created?

I'm a *nux newbie and I have some doubts regarding *nix. I don't know which type of executable file is ls, whether it is .sh or .ksh or any other kind of system executable if it is, what is that? when I tried to see what is the source code of ls command looks like, it shows something unreadabl...

linux bash shell aix

I see it already has 4 votes, so it's pretty certain to be closed

31

Q: What is the difference between a builtin command and one that is not?

Is there any intrinsic difference between a builtin command and another command which can nominally do the same thing? eg. Do builtins get "special" treatement? ... is there less overhead running them? .. or are they just simply 'built in'; like the dashboard of your car? ...and is there ...

bash shell utilities shell-builtin

@slm nope

OK, when it get's closed I'm going to ask to cycle it to be reopened

that's clearly not a duplicate

dunno why but I can't see it in the queue to push it out

5:39 PM

I even put a comment on it when I saw the dup mentioned, guess no one is reading it

odd, yeah, not showing in the close queue here either.

maybe it got closed?

No... unix.stackexchange.com/review/close/40519

enough people said leave open, I think.

unix.stackexchange.com/review/close/40519

yeah, 3 Leave open push out of the queue

ah, really? Never knew that, cool.

So then what happens, it sits there w/ 4 closes

5:42 PM

just wait for the votes to expire away

k

once it gets 100 views

And I guess the regular who voted to close why...

unless some random user decides to close

that has rep to do so

Oooh, glibc upgrade wants to restart kdm. Wonder if I'm about to get forcefully logged out... Best do this upgrade from the console.

5:45 PM

Ah, I was wondering why I couldn't see it in the review queue. Once again @Braiam knows all the little secret tips :)

@derobert I remember that there are package that when upgraded together they break things from previous conversations in IRC... glibc is one, I don't remember the other, maybe some circular dependency

glibc needs things restarted because they always break the ABI for NSS. So suddenly authentication no longer works.

this title seems incomplete unix.stackexchange.com/q/118617/41104

@terdon :)

Hah, I have both amd64 and i386 libc installed, so it restarts everything twice...

@derobert me too... so?

5:50 PM

Isn't really needed. A somewhat funny bug.

@Braiam have you somehow pissed off this Bruno guy (the AU mod) or is he always that aggressive? (re the comments here)

@terdon dunno... he seems edgy

I tried to keep the discussions as professional as possible

Yes, you did, he came in calling people stupid. Really strange to see that from a mod.

(speaking as another Unix.SE user) I'm not sure how hard it is to enable/disable a migration path, but if its not too much work, the obvious approach would seem to be turn it on for a week, and then ask on Meta.UnixSE if it should stay enabled or not. — derobert 1 min ago

@derobert that sounds like a very good idea.

@terdon Maybe he's overworked.

sadly you posted it in @terdon answer @derobert, it won't get enough views :/

6:01 PM

@Braiam well, hardly seems like it'd warrant its own answer... I guess I could?

or @terdon is free to steal the suggestion and put it in his answer

(I guess he can steel it too, if he wants...)

@derobert done

"he can steel it"?

Tried to steel, but I could only iron it.

stole it**?

O_O

@Braiam he'd written steel it instead of steal and tried to pretend it was an intentional pun :P

6:04 PM

<-- bad at English puns

Well, Wiktionary says you could "harden or strengthen; to nerve or make obdurate; to fortify against"

en.wiktionary.org/wiki/steel#Verb

@terdon I'm blown away at his tone. WOW! Perhaps he needs a break.

@slm have you seen Charles had some more comments

@Anthon - I do not think anything I have said would be controversial on the other Stackexchange sites I am familiar with. I am really astonished at this dialogue - as I suppose you are. Perhaps a meta qn is in order, either here or on meta.SO. — Charles Stewart 30 mins ago

@slm yeah, so was I. That's why I left my comment.

behold! it escalated...

@Braiam Now... I am about to call you a moron, this is beyond stupid and you are turning the fact that I called your idea stupid in to me calling you stupid. Who is taking this personal now? I will not drop to your level... It wont take much time before all of this is closed and I start ignoring you, so I recommend we stop it and leave it as it is since you already have 2 answers to your idea. — Bruno Pereira 1 min ago

6:19 PM

@terdon "On the other hand, U&L is much smaller than AU and we can deal with a good deal more questions than we are currently receiving." Er, are you sure you mean that?

@FaheemMitha well, it is true. We are smaller and we could easily handle a greater load. Just as long as it's not a load of crap.

@terdon Not sure. Anyway @derobert's suggestion of enabling for 1 wk sounds reasonable.

Are there really that many users fielding questions? half the time it seems like the high rep users are the ones answering, and just a few of them. I swear sometimes it looks like slm is answering 20% of the questions himself.

@terdon thanks for chirping in

@Anthon yes, strange though, he has enough rep on other sites to know the SE model better.

@Braiam wow...

and the come back!

@BrunoPereira that still doesn't answer my question, what is your argument against my idea of activate the migration paths to UL? What are you afraid of? Oli did a reasonable argument, what you have to offer to constructively continue the discussion? — Braiam 21 secs ago

and with that, is time that CM step up

6:25 PM

@Braiam I'd recommend just dropping it. This is not going anywhere.

@terdon well, i upvoted you, fwiw

@derobert you could move your comment to an answer - since it is basically a proposal.

@terdon upvoted your comment too.

@FaheemMitha yeah, that guy is really over the top isn't he? Mod comes from moderation for f's sake!

@terdon Agreed.

0

Q: Compare two text files and find matching lines

I have to files A and B A looks like this: 4 to 6 lines GAGA CAGA GGGT TATT file B is a really big file with thousands of lines, here is a short example: AAATGTCAAGAGACAGAAATGTCAAGAGGGT AAGGGGGTTTATAATCATAAATCAAAGAAAT ATATACAGAAATGTCAAGAGACAGAAATGTC TCAAGAGACAGAAATGTCAAGAGGGTCTATA AAGAGGGTCTA...

grep awk search string

I thought diff could do this.

@Anthon Left 2 more comments myself

in Tavern on the Meta on Meta Stack Overflow Chat, 35 secs ago, by Anna Lear

@Braiam I passed it on to the comm team, and I'm keeping half an eye on the comments. The best thing for you to do is disengage at this point.

No, perhaps not.

6:34 PM

seems the best

in Tavern on the Meta on Meta Stack Overflow Chat, 1 min ago, by Anna Lear

terdon's comment is basically what I'd say, so let's see how that works out.

did they complete that meta transition thing, or is it still in the works?

6-8 weeks IMO still

@Braiam Ok.

@Braiam damn I'm good! :)

:)

lucky you :P

6:42 PM

@terdon :-)

@slm you know you can't edit comments after 5 minutes, what are you going to do when you finally overtake Gilles?

As the #2 rep'd user on U&L I'd like to weigh in here and would welcome this, esp. if we could do it on a trial basis. I think a week is too short, perhaps 1 month? At any rate we have a lot of ppl that could participate more if we had more questions flowing in, we're by no means overworked and have excess bandwidth to deal with this. — slm 1 min ago

Or, god forbid, be overtaken by POSIXman? :P

7:00 PM

and BOOM!

I felt the need to step in and say something

Anna said enough

I think Braiam's got the right idea, I think the AU mods are overworked and are looking at this activity as more work to them

Developing this migration relationship is likely going to take effort from both communities but IMO these Q's are a untapped source for U&L and are an added burden to AU. Both communities could benefit from this. We already share a fair amount of users (I see several AU users w/ fair amounts of rep on U&L) as you should recognize many of the U&L users frequenting AU. This seems like a logical step to me, assuming we get enough ppl buying into the idea! — slm 3 mins ago

was my 2nd comment

@terdon I will never pass Gilles

That's LOOSER talk!

sorry coach

I'm in my 3rd gear he's in 2nd

he could turn it up if he cared to

7:03 PM

Look, Stephane and I started almost on the same day. How do you think I feel? :)

2

heh

I tell my kids all the time, there is always someone better than you, that shouldn't be how you gauge yourself, it's more important how ppl remember you

or how you want them to remember you

Any idea why the error here is so unhelpful?

Perhaps try running the prerm script manually? For some reason the error is getting swallowed up. — Faheem Mitha 25 secs ago

@slm Positive thinking. Good stuff.

Afaik dpkg does not swallow errors.

@terdon That should be LOSER. :-)

Unlike you think @slm is somehow getting looser.

I feel admiration for some people, but I don't gauge my value nor anyone else against them, each one is unique in their own way

@slm Hmm, I'm not sure what the evidence for "by no means overworked and have excess bandwidth" is.

7:12 PM

@FaheemMitha answered %

@Braiam Ah, and that is where? On area 54?

I remember being kinda pissed when @terdon went from half my points to double,lol. Screw being unique, I want the money.

@goldilocks Money? What money?

@FaheemMitha stackexchange.com/sites#technology-percentanswered

@goldilocks heh, I remember, I had you in my sights! :)

7:14 PM

@Braiam answered 85%. And one concludes what from that, exactly?

@FaheemMitha no, that was looooooooooooser talk!

@FaheemMitha Sorry, figurative. I meant all that counts is winning ;)

and loose talk as far as that goes :)

@terdon You should have put more O's in there.

@FaheemMitha you think that's not enough?

7:15 PM

Yikes, AU is 66%? Is this measuring accepted answers, or just answers?

@Braiam depends what is means. ^^

@FaheemMitha questions that has at least 1 upvoted or accepted answers

@Braiam Ok. That's a low bar.

So at least one question with at least one upvote, or an accepted answer. well, the former is definitely a low bar

@FaheemMitha I'm not sure if you've noticed by I've been intentionally not answering Q's as aggressively, I'm trying to leave more on the table since we've had an influx of new users I'm hoping that many of them will stay around

@slm No, I hadn't noticed. But good move. Hadn't really noticed the new users either.

I could regularly get 300+ pts a day in answering but I've been trying to stay @ 200 now, leaving many Q's. I usually go through them at night and if I see something grossly missing or a unanswered Q that has sat for a couple of hours I'll try and tackle those

yeah it's like taking all the oxygen out of the room

Gilles seems to be doing a similar thing, makes sense, but getting more Q's here is ultimately what we need to do

7:25 PM

@slm Ok. Surprised you have so much energy.

dunno just do

I just stepped in to the AU chat room and they have a bot that posts Qs from here that are tagged as Ubuntu. We might want to implement the inverse and have Qs pasted here that are tagged as anything but Ubuntu on Ask Ubuntu.

I don't know if the number of questions is the issue - better quality would be nice.

@Braiam did this link do something?

stackexchange.com/sites#technology-percentanswered

I think you drive it on both fronts

@slm Well, there are 7 billion people on the planet. Maybe 500 million with internet access (possibly optimistic estimate). I guess there would be a few people out of there who are willing to answer unix questions for free online. :-)

7:29 PM

we can still close crappy Q's

We're actually petty good on quality here. I speak as a high rep Super User user. What low quality questions we do get are either closed quickly or improved.

@slm it links to technology based sites and orders them by % answered

This is like community service to me

ah

@slm I do it for the internet points :P

jk

wait so there isn't a general store where I can cash in my 60k points? I'm out of here....

3

@Braiam @FaheemMitha - looking at the stats AU get's an avg. 210 Q/day. We get 60 so is another 10-20 Q's gonna break this site?

7:37 PM

@slm No.

@slm ssh, don't say such things publicly. people might catch on.

@terdon I'm completely spoiled on this site

Maybe we'll get lots more questions with people trying to backport without backporting. yay.

I can't join other communities that get a normal level of crap now because I'm used to nice it is here

@strugee Awww.

:D

7:45 PM

@strugee that's known as a first world problem :)

@terdon I know, I know...

worth watching solely for his animation about being horrified about systemd

it's within the first couple of minutes

@slm You can cash them in for answers on questions by placing a bounty. There is a question about cows that I'd recommend.

8:01 PM

@strugee I totally relate to that. Amazing how much nicer something seems after you give it a chance and read the documentation. Except for pulseaudio, in which case suicide is the only sane option.

COWS EVERYWHERE! COWS I SAY!

@goldilocks What's wrong with pulseaudio? Other than the lack of documentation.

@strugee reminds me, I need to try and get systemd work on that media PC again this weekend. I was surprised, though, that it didn't improve boot time. (And it didn't shut down, and broke video playback...)

@derobert I'm only half serious. My experience w/ it is limited, since when it first appeared it never worked out of the box, so I'd just disable it and use alsa. My last kick at the can was using it as a sound server so I only needed speakers plugged into one box. Which there are at least three ways of accomplishing this, but I have yet to here of anyone doing it without a full 1-2 seconds of latency being introduced, meaning it is useless for video...

...which to be harsh implies software that tries to be too many things to too many people on too many platforms == does a lot but in a very lackluster way.

I haven't tried it as a sound server over network, but for local video playback it definitely works. It introduces some latency, but measurable, so the video player compensates.

Its definitely not a low-latency solution.

8:16 PM

Sure but then what's the point? The lower level (ALSA) already works for video, and with less trouble since you don't need, e.g. a flash plugin. Serving on a network, OTOH, is something ALSA doesn't do, AFAIK.

@goldilocks ALSA doesn't give you per-app volume control.

And you don't need a flash plugin for pulse. The pulse alsa plugin works fine

Nor does ALSA let you re-route ongoing streams (e.g., from speakers to headphones)

Or have a consistent API for recording sound output (useful for, say, screen capture)

sighs

@Braiam ?

storm haven't subsided yet...

@derobert Hmm, okay, it's configuring ALSA to route to pulseaudio...when I have had it enabled, I've always ended up having to watch flash in firefox because there is no sound w/ chrome. Whereas there is w/ alsa. I'm kind of a crotchy judge here since I really don't care about audio most of the time -- don't even have the speakers on. So stuff like simultaneous streams, per app volume, I'd never make use of it anyway. I just want to be able to hear something when I want to hear something.

8:22 PM

weird, right now alsa is not used in my hardware

crotchy -> crotchety. Whoops.

@goldilocks apt-get remove --purge pulseaudio used to be one of the first config tasks I did on a system. Burn it. Burn it WITH FIRE. But then I tried it out again a year or so ago... and well, now I've been slowly converting my systems over. It turns out it has better support for bluetooth audio sources, too...

html5 -> iceweasel -> pulse -> hardware

@goldilocks Odd. Make sure you're using the pepper flash plugin, not the ns plugin api one.

@derobert Yeah if I were doing more stuff w/ sound I'm sure I'd apply myself to it more too. But I spend all freaking day trying to get stuff working -- when I go to watch a 2 minute youtube joke the last thing I want is to have play sys admin some more. Basically I hate everyone else's software, lol.

8:29 PM

Hah, I know what you mean...

There is a reason I still use screen. tmux? Yeah, maybe I'll look at it someday...

BTW: chrome://plugins/ , hit details to the right, and scroll down to your flash player... make sure it's the PPAPI one, not the NPAPI one. And you'll have much better flash experiences in Chrome.

@derobert PPAPI / NPAPI what is that?

@derobert : Not sure if I have either of those? It's the Adobe one.

Mine is NPAPI. Whatever that is.

Whoops yeah details -- PPAPI.

@FaheemMitha NPAPI is the Netscape plugin API, which is originally from Netscape Navigator, though I'm pretty sure its been changed. But it's the native plugin API of Mozilla.

PPAPI is Chrome's plugin API

8:34 PM

@derobert This still applies to chromium?

@FaheemMitha Yes.

If it is better, how do I get the other one?

wiki.debian.org/PepperFlashPlayer

apt-get install pepperflashplugin-nonfree basically

@derobert And this is definitely better in your opinion?

Yes. For one thing, its flash 12 instead of 11. Seems to perform better, too.

8:37 PM

@derobert Ok, I'll give it a try, Thanks for the tip.

should i install the version from testing/unstable, or wheezy-backports?

Well, if you're running wheezy, you should probably use the version from backports.

I think you'll wind up with the same version of flash.

12,0,0,44

@derobert Ok. I guess i could backport the one from testing/unstable, but probably not worth it.

metadata.ftp-master.debian.org/changelogs//contrib/p/… ... definitely not worth it.

@derobert Ok. I wonder why pepper

I don't know where Google came up with that name from.

PPAPI = Pepper API. support.google.com/chrome/answer/108086?hl=en

BTW: NPAPI flash on Linux is EOL. Adobe will be stopping security support at some point. Also, Chromium 34 will be dropping NPAPI support, supposedly.

8:48 PM

Google Native Client

:Not to be confused with Networking and Cryptography library. Google Native Client (NaCl) is a sandboxing technology for running a subset of Intel x86 or ARM native code in a sandbox. It is proposed for safely running native code from a web browser, allowing web-based applications to run at near-native speeds, which aligns well with Google's plans with Chrome OS. It may also be used for securing browser plugins, and in the future parts of other applications or full applications. To demonstrate the readiness of the technology, on 9 December 2011, Google announced the availability of sev...

@derobert I see.

@derobert I can confirm chromium 34 on gentoo will not load the adobe plugin

@terdon @Braiam @slm Here's a potentially interesting development in the AU migration debate: "goldilocks I actually like that point of view, really good way of putting things. Thanks – Bruno Pereira" (from the question comments, mine is a couple before that). Although I worry the S.E. powers that be may have heard this one before, and since on S.O. itself the number is still 5, they ain't gonna change...

@goldilocks and they will not change

...but it is an issue on the rpi beta site too, because instead of too many people with their finger on the close button, we can't find enough.

in early states of graduated you can get 3-4 people to close a Q, but 5 is the maximum

9:00 PM

I'll have to pay more attention to the rpi numbers, I could be wrong about that. But it's frustrating.

to delete closed questions you need 3-10 users to agree based on votes

i have GlassFish v1 plugin activated in netbeans yet i m not able to use it ..how can i do this?

@Vishwas you sure he's the right place to ask?

nope ..sorry

where can i ask this

@Vishwas unix.stackexchange.com/questions/ask

9:06 PM

thanx

I'm not familiar enough with those two programs to know if you should ask on Unix.SE or on Stack Overflow

if its on topic here

i cant say for sure

If its a program you're running on a Unix box, it's on-topic here. But it may also be on-topic on SO, check their help section...

(Well, of course, if it involves writing code, then it may not be on topic here...)

stackoverflow.com is a much bigger site

netbeans appears to be an IDE that runs on windows, macos, solaris, linux and presumably any suuported java platform

9:23 PM

I love how Arqade can take something out of context so beatifull

@Braiam LOL

@Braiam This is a strange site.

maybe they should have a howtolietomygirlfriend.sx site.

9:39 PM

@FaheemMitha "strange"?

@Braiam Yup.

@FaheemMitha don't you mean "arqade"?

@Braiam Nope

9:57 PM

@Braiam They don't hold a candle to ell users, apparently: ell.stackexchange.com/questions/18538/…

I'm presuming @FaheemMitha is playing on the idea of cheating, BTW.

10:41 PM

@goldilocks Something like that.

1 hour later…

11:50 PM

@derobert I'm familiar w/ glassfish I can answer it if he asks

@slm doesn't appear @Vishwas has.

@Vishwas whatever happened to your glassfish question? Doesn't appear you've posted it.

@derobert OK, if he asks I have a feeling I'll see it 8-)

Well, not if he/she posts to SO instead of here...

@derobert - right, I only meant if he posts it here

@derobert catching up, just fell out of my chair when I read this one

@slm :-D

« first day (1245 days earlier) ← previous day next day → last day (3692 days later) »

Transcript for

Mar '147

/dev/chat

General discussion for unix.stackexchange.com. If you have a q...

join this room
about this room

00:00

06:00

12:00

18:00

all times are UTC

site design / logo © 2024 Stack Exchange Inc; legal

mobile