Ask Ubuntu General Room - 2019-07-18

« first day (3214 days earlier) ← previous day next day → last day (1734 days later) »

WinEunuuchs2Unix

12:43 AM

@terdon I'm in total agreement. I feel guilty closing an 14.04 or 18.10 question when the same problem might exist in 18.04 or 16.04. And the same solution would apply to all versions. Even Linux Mint I'll look the other way and not initiate close voting if it's a kernel problem or driver issue. Once initiated by someone else though I have to vote along because it's procedure / protocol / politically correct.

Ubuntu Questions on U&L

1:04 AM

0

Q: hiDPI scaling fix for Davinci Resolve 16 in Gnome

I asked a similar question about hiDPI scaling here. This question regards fixing scaling on a specific application, the other question is about a universal hiDPI mode. I am running ubuntu derivative Pop!_OS 19.04 in Gnome I built a .deb package for DaVinci Resolve 16 with MakeResolveDeb and it...

ubuntu gnome high-dpi

5 hours later…

6:19 AM

@WinEunuuchs2Unix oh if I can get away with it I will just remove mint or version tags :-)

6:37 AM

systemd strikes again: phoronix.com/… AMD Ryzen 7 3700X + Ryzen 9 3900X crash during installation due to systemd crashing

1 hour later…

Ubuntu Questions on U&L

7:46 AM

0

Q: Ubuntu Server Installation media boots to weird installation menu

This is probably a noob question so sorry in advance! When I boot the Ubuntu Server installation disk, It boots to this weird screen with a ton of green "OK's" and text instead of the typical installation screen: https://tutorials.ubuntu.com/es6-bundled/src/codelabs/tutorial-install-ubuntu-serve...

Ubuntu Questions on U&L

8:26 AM

0

Q: I broke my Alt-drag windows feature on Ubuntu MATE 18.04

I just installed Ubuntu 18.04 MATE, and while fiddling with it and installing a ton of apps and configuration that I need for work, somehow I managed to make it so Alt-click-and-drag no longer moves a window (and Alt-rightclick no longer resizes it). I would very much like to restore that functi...

ubuntu window-manager mate-desktop

2 hours later…

Ubuntu Questions on U&L

10:46 AM

0

Q: Docker service not starting on new WSL2

Im trying to start docker in the brand new WSL2 with the following command : sudo service docker start then: sudo service docker status result : * Docker is running BUT on running the test container with : sudo docker run hello-world Error:docker: Cannot connect to the Docker daemon at ...

ubuntu windows docker windows-subsystem-for-linux

1 hour later…

Ubuntu Questions on U&L

12:06 PM

0

Q: Histogram with FASTA file

I am new to Linux. I have a FASTA file that looks something like this: >scaffold1 AAGACATAATATTTTGGAGGAATTAAAAAATTTAAGATGTATTTTATTATACATGTATTTTATTTATAACATAAATAAACATCCCAAGGAAAAGCAGTAGCT >scaffold2 AAGGATAAGTGTAGCTGAGGAATTAAAAAATTTAACAAATAAAATTAATGCAATTTATTTTTTCAAATAAAAATACACGGAGAAAAATAATTTGTAAATT...

2 hours later…

Ubuntu Questions on U&L

2:26 PM

0

Q: Access Ubuntu desktop remotely from Mac OS

I would like to be able to access my Ubuntu 18.04 desktop (not just terminal) from Mac OS (Mojave), and have tried a couple solutions, with less-then-desirable results: Installing google chrome remote desktop caused terminal to not launch properly. XRDP would only display a blank screen on the ...

linux ubuntu osx vnc remote-desktop

Ubuntu Questions on U&L

2:46 PM

0

Q: Login Loop Black Screen when opening terminal

I'm having a huge problem that is made of different small problems. I'm Caught in a login loop but when I call a terminal to fix the problem I end with a black screen asuming there is something wrong with the display. On top of that when i try to boot from my usb with the external option of the b...

ubuntu login gnu-screen loop-device

1 hour later…

3:49 PM

It always baffles me how (it seems) few people know how to use bash options and in consequence how much rep one gets with things as simple as globstar and extglob (a recent example being askubuntu.com/a/1159032/507051) – as bad as RTFM is, man bash simply is a worthy read. I know computer science graduates who never saw sudo !! before I showed it to them…

4:28 PM

Can we consider, The comments have been moved to chat comment by mods as obsolete if the issue has been solved in chat?

@dessert I know. man page answers are rep magnets :D

4:44 PM

@dessert If you think that's impressive, imagine how I felt when I had to explain what a gene is to a bloody medical doctor!

WinEunuuchs2Unix

5:07 PM

Interesting question of the day is about Ubuntu Spyware: askubuntu.com/questions/1159154/… which is unfortunately closed as a duplicate of this question: askubuntu.com/questions/226575/ubuntu-with-spyware which has been locked down by @oli. How can all Ubuntu software be on-topic except Ubuntu Spyware from Canonical? Or should the question be reopened and closed to a duplicate that isn't locked down?

@WinEunuuchs2Unix It is on topic, but it is also a dupe. And the spyware is apparently no longer on by default so it isn't really relevant. And the OP is using 16.04 anyway.

@Rinzwind I'm not oozing, and what bias would you be referring to? It's what gnu.org said. I have a laptop with 16.04, and I wanted to disable...whatever you want to call it. — jj1 10 hours ago

But as a general rule, I would say that if Canonical were indeed dumb enough to try something like this again, so it would affect currently supported releases, then it would absolutely be on topic.

Hey @terdon!!! Can you please answer this?

OH hey, I missed that. I would generally say no. Unless the chat discussion has now been incorporated into the answer.

WinEunuuchs2Unix

@terdon @terdon My concern is it's impossible to post an answer on the duplicate because it's locked down. Also /etc/cron.daily/popularity-contest isn't mentioned and I'd like to post an answer on how to disable this "information gathering" software.

5:23 PM

@WinEunuuchs2Unix Well yes, but why would you want to post an answer? Isn't this now very old news and no longer relevant to any supported version of Ubuntu?

WinEunuuchs2Unix

@terdon If I encountered /etc/cron.daily/popularity-contest yesterday how is it old news?

What's this popularity-contest thing? Maybe it deserves a dedicated Q&A?

WinEunuuchs2Unix

@terdon I wouldn't go so far as to call it spy-ware but paranoidpanda probably would if is user account wasn't gone.

@WinEunuuchs2Unix The question you linked to was about a very specific thing tried out in Ubuntu ~16 or so, which RMS found out about and (correctly, IMO) railed against. This made a lot of noise and led to various posts on the subject. However, the software in questin has either been disabled or removed or is otherwise no longer relevant to currently supported releases.

So if there's some new spy/adware thing, a new question would probably be the way to go.

WinEunuuchs2Unix

@terdon It's not adware. It simply gathers information on your machine and sends it to Canonical.

5:26 PM

@terdon Actually I flagged a comment by Thomas as obsolete and wrote, solved in chat. But it was declined. Yes I incorporated the discussion into the answer to the point where it's relevant. I guess I had to add incorporated into the answer when I flagged. Here is the link in case you want to look.

@WinEunuuchs2Unix Sheesh. Then by all means, post a question about it if we don't have one already. But that isn't really a valid answer to the question(s) you linked to since they both talk about the specific "feature" that's been disabled since 16.04.

WinEunuuchs2Unix

I wonder if it's possible to put a trace on /etc/cron.daily/popularity-contest to see what files it access and what IP address it sends the information to?

@terdon You win. That's about shopping lens or something. I give up :)

@Kulfy What's the benefit of deleting that though? I mean, the discussion might still be interesting, someone might want to continue it and it's just one comment. Deleting it might lead to accusations that we're trying to hide things or whatever.

@WinEunuuchs2Unix probably. strace might be able to do it, somehow.

WinEunuuchs2Unix

@Kulfy Thomas's daily passion after second cup of coffee is moving comments to chat :P

@WinEunuuchs2Unix Do let me know if you look into this, it does sound pretty ugly.

WinEunuuchs2Unix

5:29 PM

@terdon Well first I'd have to learn how to use strace, ptrace and itrace (whatever it is called if it exists yet).

@terdon I didn't think about that. Fair call.

@WinEunuuchs2Unix Yeah, strace has all sorts of fancy options. I tend to just run strace command 2>out and grep for things.

@WinEunuuchs2Unix Yeah it seems so. I don't know how he smells a long discussion is going on in comments

this dude is making me annoyed :P askubuntu.com/questions/1058783/…

@WinEunuuchs2Unix "This package sends every week the list of packages installed and the access time of relevant files to the server via email." :=)

pretty vague :S

@WinEunuuchs2Unix pop contest is disabled by default. you need to activate it.

oh the script is /usr/sbin/popularity-contest

popularity-contest | grep '<OLD>'
will list what it does

rinzwind@schijfwereld:~$ popularity-contest | grep '<OLD>'
1555416000 1561723200 aspell-en /usr/lib/aspell/en_US-wo_accents-only.rws <OLD>
1555329600 1561723200 parted /sbin/partprobe <OLD>
1555070400 1561723200 language-pack-en-base /var/lib/locales/supported.d/en <OLD>
1554984000 1561723200 gnome-maps /usr/bin/gnome-maps <OLD>
1554984000 1561723200 fwupd-signed /usr/lib/fwupd/efi/version <OLD>

@terdon nah it is pretty benign.

5:46 PM

@Rinzwind It's sending data from my machine to a private company. That isn't benign. Granted, in this day and age, that is hardly among the worst offenders, but still.

no it is not -unless- you activated it.

the default is disabled/

oh and unless you use ... edgy. That one was opt-in iirc

but I do agree that opt-in was one of the worst decisions Canonical ever made. really nobody there predicted the fall-out that would cause? :P

LOL @ picture https://askubuntu.com/questions/1159240/maas-python-permission-error
cant enlarge it so it is tinyyyyyyyyyyyyyyyyyyy :D

WinEunuuchs2Unix

6:16 PM

@Rinzwind I might like to use this popularity-contest to gather information on my four distro's and email it to myself (not Canonical). It could be part of my disaster recovery plan. Is it open source?

yeah it is. at its heart it is a debian tool not ubuntu/canonical

https://popcon.ubuntu.com/ is the website. has lots of info.
numbers are based on 2.8m submissions

the archive is here: alioth-archive.debian.org/releases/popcon/popcon @WinEunuuchs2Unix

but you can just execute it commandline and pipe the results :=)

WinEunuuchs2Unix

Archive has a note in it: "**SECURITY NOTE: it's impossible to make a submission completely anonymous,
since Internet servers tend to add headers and log messages along the way.
Our receiver program at debian throws away this information as soon as
possible so no one will see it, but if you're really paranoid you might not
want to participate.**"

lol empashis on 'REALLY PARANOID'

WinEunuuchs2Unix

I wonder if ParanoidPanda was really paranoid and that's why he deleted his account in Ask Ubuntu? :P

a middle man attacker would not care about pop contest :P he wants credit cards and password

WinEunuuchs2Unix

6:26 PM

Google is the real middelman and he want's to know what you buy, when, where, why and what color of shoes you were wearing that day.

what is send is totally not interesting except for someone who wants to set up a popularity contest website. People bitch about how it is unknown how many people use Ubuntu. This makes an attempt and now another set of people bitch about spyware. :P there is no pleasing people.

if you use anything google. that is the browser, or an android phone you sold your soul to them :P
same with apple and their products and microsoft and their products. compared to that Canonical made a mistake once :P

True.

WinEunuuchs2Unix

Oh look sequay to yesterday's conversation, `logrotate` is installed more often than `cron` which is needed to call it: 4 logrotate 2788893 8808 2778812 102 1171 (Paul Martin)
5 cron 2788186 9612 2777444 138 992 (Javier Fernandez-sanguino Pen~a)

Although Apple is a bit diferent too. As is, possibly, Microsoft. Companies like Google and Facebook have based their entire business plan on collecting and sharing your data.

@WinEunuuchs2Unix That's probably because of systemd's cron replacement.

well apples does not have a browser hat powerful. MS does. But both are small compared to google

even burner emails dont work.

WinEunuuchs2Unix

6:33 PM

Telegram is a relatively new company that is big on encrypting your messages. Then the carriers can't read it (or NSA I guess) which is kind of appealing (if I ever get to have any secrets).

and then there is the business side: I am forced to use gmail and microsoft emails :P

@WinEunuuchs2Unix But they only do messaging, right?

don't put to much trust in encrypting messages. it is "security by obscurity"

@Rinzwind Why do you say that?

Do you mean that you don't believe they actually encrypt or that encrypting is just security by obscurity?

there have been examples of encryption where it looked easy for law enforcement to access it.
There was a prime example in The Netherlands: someone sold phones with encryption that would even scramble voice. Not just messages. Used by criminals and from the start police was able to listen in on those phones.

6:37 PM

@Rinzwind So the police were given keys then.

ofcourse. by the person selling the phones. He got paid for that _O-

rundown: dude sold phones

OK. I thought you were suggesting that encryption is nothing but security by obscurity which seemed strange.

yeah well. the openssl debacle is also fresh in my memory. software where an NSA employee worked on and delliberately left a hole open to abuse.

here is a dutch article on that dude: nrc.nl/nieuws/2016/04/20/…

WinEunuuchs2Unix

I wonder how Snowden is doing in Russia

@Rinzwind Haha the link isn't in english :P

I said "dutch" :+)

did you not get an translate option? >:)

Ubuntu Questions on U&L

6:46 PM

0

Q: UFW Drop inbound ICMP requests from outside the local network

How do I use ufw to drop inbound icmp traffic from outside my local network? Local network/mask is 10.0.2.0/24.

ubuntu networking iptables firewall ufw

WinEunuuchs2Unix

@Rinzwind Using firefox. Chrome used to translate automagically.

google. -> soul sold

WinEunuuchs2Unix

google search is kinda handy for making points in Ask Ubuntu though :P

true :D

WinEunuuchs2Unix

<--- Sold is soul for points HAHA

6:48 PM

well I decided back in the day to stick with google and ignore apple and microsoft. I can totally ignore apple but MS not totally. google know all about me though

oh I started using duckduck a little while back but their results are not as good as googles.
and opera with permanent vpn too

firefox for netflix and chrome for normal browsing

time to turn on my PS4. BBL :)

7:06 PM

@WinEunuuchs2Unix He's doing all right

He stopped learning Russian though...

... and works as a free-lance advisor.

WinEunuuchs2Unix

@Fabby I never thought he'd be that keen on learning Russian in the first place. Maybe just "Spasiba"

3 hours later…

Ubuntu Questions on U&L

9:46 PM

0

Q: Copy/Cut/Paste in TMUX

I know this has been asked, but I am honestly unable to get any of the examples to work. Maybe because I am misunderstanding some technical shorthand. I am looking for the basest of cases. I am running in Ubuntu 18.04 and the latest tmux. When I use the mouse to select some text in tmux (e.g. a...

@WinEunuuchs2Unix It's a tough language, but it's not Chinese...

« first day (3214 days earlier) ← previous day next day → last day (1734 days later) »

Transcript for

Jul '1918

Ask Ubuntu General Room

Normally: General discussion around Ask Ubuntu, Ubuntu & offic...

join this room
about this room

00:00

06:00

12:00

18:00

all times are UTC

site design / logo © 2024 Stack Exchange Inc; legal

mobile